Incidental Mutation 'R5770:Hcrtr2'
ID446501
Institutional Source Beutler Lab
Gene Symbol Hcrtr2
Ensembl Gene ENSMUSG00000032360
Gene Namehypocretin (orexin) receptor 2
SynonymsmOXR2, OX2r, mOX2aR, mOX2bR
MMRRC Submission 043370-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5770 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location76225880-76323856 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76259666 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 130 (I130F)
Ref Sequence ENSEMBL: ENSMUSP00000139377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063140] [ENSMUST00000184757]
Predicted Effect probably damaging
Transcript: ENSMUST00000063140
AA Change: I130F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058230
Gene: ENSMUSG00000032360
AA Change: I130F

DomainStartEndE-ValueType
Pfam:7tm_1 71 364 2.2e-59 PFAM
Pfam:Orexin_rec2 386 443 1.2e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184757
AA Change: I130F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139377
Gene: ENSMUSG00000032360
AA Change: I130F

DomainStartEndE-ValueType
Pfam:7tm_1 71 364 1.2e-59 PFAM
Pfam:Orexin_rec2 383 443 2.2e-47 PFAM
Meta Mutation Damage Score 0.1254 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 93% (64/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor involved in the regulation of feeding behavior. The encoded protein binds the hypothalamic neuropeptides orexin A and orexin B. A related gene (HCRTR1) encodes a G-protein coupled receptor that selectively binds orexin A. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice bearing targeted mutations in this gene exhibit fragmentation of sleep/wake states with similarity to narcolepsy and rare or very rare episodes of cataplexy. In addition, mice homozygous for a funtionally null allele display enhanced depression-likebehavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030C10Rik T C 12: 20,815,459 noncoding transcript Het
Abhd8 A G 8: 71,457,328 V392A probably benign Het
AI481877 T C 4: 59,092,466 I238M probably benign Het
Alpk3 A G 7: 81,078,562 E480G probably benign Het
Ankfy1 C G 11: 72,760,256 H1011D probably damaging Het
Aoc3 T G 11: 101,331,752 Y271* probably null Het
Bcl9 T C 3: 97,215,175 I103V probably benign Het
Cgnl1 C T 9: 71,645,487 probably null Het
Cyp2c23 T A 19: 44,021,579 D109V probably damaging Het
Cyp2j13 A T 4: 96,077,432 W13R probably benign Het
D630003M21Rik T C 2: 158,195,580 probably benign Het
Desi2 A T 1: 178,256,495 probably benign Het
Dll3 T C 7: 28,299,009 E177G possibly damaging Het
Ern2 C T 7: 122,179,907 G238D possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm6133 A G 18: 78,350,249 K153E probably benign Het
Gpr68 A T 12: 100,878,821 Y155N probably benign Het
Hk1 T C 10: 62,286,449 K489R probably benign Het
Ints13 T C 6: 146,555,073 N425S probably damaging Het
Itpkc T C 7: 27,212,988 D578G probably damaging Het
Kcns3 A G 12: 11,092,249 S150P probably benign Het
Khdrbs3 T A 15: 69,049,463 probably null Het
Kif11 A G 19: 37,390,865 I335V probably benign Het
Lrrn4 C G 2: 132,872,156 C290S probably damaging Het
Macrod2 T C 2: 141,232,182 probably benign Het
Mgam A G 6: 40,669,804 N688S probably benign Het
Myh8 G A 11: 67,297,200 E933K probably damaging Het
Nat8f5 T C 6: 85,817,675 Y101C probably damaging Het
Nhlrc1 A G 13: 47,014,712 V23A probably benign Het
Nkx2-3 T A 19: 43,614,533 F193I probably damaging Het
Nlrp4b T A 7: 10,715,487 V172E probably benign Het
Nmrk1 G T 19: 18,645,074 R172S probably benign Het
Nudcd3 T C 11: 6,113,286 D201G probably damaging Het
Olfr1255 T A 2: 89,816,549 D68E probably damaging Het
Olfr1384 A G 11: 49,514,592 E318G unknown Het
Olfr205 A T 16: 59,329,151 Y119* probably null Het
Olfr314 G A 11: 58,786,594 R120H probably benign Het
Olfr46 A G 7: 140,610,943 Y259C probably damaging Het
Olfr679 A T 7: 105,090,895 I248N probably damaging Het
Olfr980 C T 9: 40,006,338 V204I probably benign Het
Oprm1 G A 10: 6,789,026 G51D probably damaging Het
Pcdh15 T A 10: 74,185,345 Y130* probably null Het
Pcdh9 G A 14: 93,886,943 T597I probably damaging Het
Pcdhb19 A G 18: 37,498,037 N295S possibly damaging Het
Pcnx3 T C 19: 5,681,579 probably benign Het
Pdzph1 A T 17: 58,879,151 I1215N probably damaging Het
Phf21a C T 2: 92,351,854 T405I possibly damaging Het
Pkd1l2 C A 8: 117,055,018 G763W probably damaging Het
Prox2 A G 12: 85,087,380 F591L probably benign Het
Robo3 T A 9: 37,419,201 H1033L possibly damaging Het
Sdha A T 13: 74,323,120 C222* probably null Het
Sec16a T C 2: 26,414,390 D2303G probably damaging Het
Slc16a5 A G 11: 115,472,778 K422E possibly damaging Het
Slc22a30 A T 19: 8,386,527 M232K probably damaging Het
Slc35b3 A T 13: 38,937,758 F300I probably damaging Het
Spata2l A G 8: 123,235,720 V34A probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tecta T A 9: 42,345,589 Q1597L possibly damaging Het
Tgfb1i1 A T 7: 128,248,547 probably benign Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tpm3-rs7 A G 14: 113,315,375 T234A probably benign Het
Usp20 A G 2: 31,017,508 Y684C probably damaging Het
Zc3h4 T A 7: 16,429,611 M585K unknown Het
Zfp292 A G 4: 34,806,747 I2099T probably damaging Het
Other mutations in Hcrtr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Hcrtr2 APN 9 76228155 missense possibly damaging 0.86
IGL00492:Hcrtr2 APN 9 76246441 missense probably damaging 1.00
IGL00782:Hcrtr2 APN 9 76230497 utr 3 prime probably benign
IGL03096:Hcrtr2 APN 9 76254626 missense probably benign 0.01
PIT4508001:Hcrtr2 UTSW 9 76246380 nonsense probably null
R0038:Hcrtr2 UTSW 9 76259681 missense probably benign 0.00
R0038:Hcrtr2 UTSW 9 76259681 missense probably benign 0.00
R0268:Hcrtr2 UTSW 9 76228188 missense probably benign
R0389:Hcrtr2 UTSW 9 76246380 nonsense probably null
R0499:Hcrtr2 UTSW 9 76254672 missense probably damaging 1.00
R0607:Hcrtr2 UTSW 9 76230684 missense probably benign 0.00
R1622:Hcrtr2 UTSW 9 76323440 missense probably benign 0.03
R1637:Hcrtr2 UTSW 9 76232999 missense probably benign
R1698:Hcrtr2 UTSW 9 76246453 missense probably damaging 1.00
R1856:Hcrtr2 UTSW 9 76259785 missense probably damaging 1.00
R1876:Hcrtr2 UTSW 9 76246345 critical splice donor site probably null
R3411:Hcrtr2 UTSW 9 76233008 missense probably benign 0.30
R4469:Hcrtr2 UTSW 9 76230556 missense probably benign 0.30
R4560:Hcrtr2 UTSW 9 76254688 missense probably damaging 1.00
R4797:Hcrtr2 UTSW 9 76254534 missense probably damaging 1.00
R5001:Hcrtr2 UTSW 9 76230604 missense probably benign 0.00
R5027:Hcrtr2 UTSW 9 76323296 missense probably benign 0.31
R5611:Hcrtr2 UTSW 9 76323314 missense probably damaging 0.98
R5826:Hcrtr2 UTSW 9 76323287 missense probably benign 0.32
R6023:Hcrtr2 UTSW 9 76230604 missense probably benign 0.00
R6110:Hcrtr2 UTSW 9 76259782 missense probably damaging 1.00
R7084:Hcrtr2 UTSW 9 76230660 missense probably benign 0.21
R7103:Hcrtr2 UTSW 9 76254511 missense probably benign 0.00
R7173:Hcrtr2 UTSW 9 76259731 missense probably damaging 1.00
R7783:Hcrtr2 UTSW 9 76232914 missense probably damaging 1.00
R8255:Hcrtr2 UTSW 9 76232921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTCTTTTATGATGAGGACTGTG -3'
(R):5'- ATCTATCAGTCTGTGTGGCAG -3'

Sequencing Primer
(F):5'- GTTGCCTCCATTTTATCTAGGCATG -3'
(R):5'- CTGTGTGGCAGTGTGGAAGAAC -3'
Posted On2016-11-21