Incidental Mutation 'R5770:Ankfy1'
List |< first << previous [record 100 of 1826] next >> last >|
ID446510
Institutional Source Beutler Lab
Gene Symbol Ankfy1
Ensembl Gene ENSMUSG00000020790
Gene Nameankyrin repeat and FYVE domain containing 1
SynonymsAnkhzn
MMRRC Submission
Accession Numbers

Genbank: NM_009671.5

Is this an essential gene? Possibly essential (E-score: 0.637) question?
Stock #R5770 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location72690006-72772146 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 72760256 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Aspartic acid at position 1011 (H1011D)
Ref Sequence ENSEMBL: ENSMUSP00000118751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127610] [ENSMUST00000155998]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102548
Predicted Effect probably benign
Transcript: ENSMUST00000127610
SMART Domains Protein: ENSMUSP00000118252
Gene: ENSMUSG00000020790

DomainStartEndE-ValueType
Blast:UBCc 4 33 3e-8 BLAST
BTB 68 162 3.26e-20 SMART
Blast:ANK 217 247 6e-8 BLAST
ANK 255 284 5.29e0 SMART
ANK 288 317 1.04e2 SMART
ANK 322 362 4.3e0 SMART
ANK 366 395 4.73e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147195
Predicted Effect probably damaging
Transcript: ENSMUST00000155998
AA Change: H1011D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118751
Gene: ENSMUSG00000020790
AA Change: H1011D

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
BTB 68 162 3.26e-20 SMART
ANK 255 284 5.29e0 SMART
ANK 288 317 1.04e2 SMART
ANK 322 362 4.3e0 SMART
ANK 366 396 9.75e1 SMART
ANK 400 452 8.5e2 SMART
low complexity region 465 478 N/A INTRINSIC
ANK 490 519 4.56e-4 SMART
ANK 542 572 3.18e-3 SMART
ANK 588 617 1.72e1 SMART
ANK 621 650 5.16e-3 SMART
ANK 654 683 8.14e-1 SMART
ANK 687 716 5.37e-1 SMART
ANK 724 753 3.08e-1 SMART
ANK 769 798 2.56e-7 SMART
ANK 802 830 1.93e-2 SMART
ANK 836 865 3.47e2 SMART
ANK 870 899 9.49e-2 SMART
ANK 905 934 2.41e-3 SMART
ANK 938 967 1.34e-1 SMART
ANK 971 1001 4.43e-2 SMART
Blast:ANK 1005 1039 2e-16 BLAST
ANK 1043 1074 5.67e0 SMART
FYVE 1099 1165 3.98e-28 SMART
Meta Mutation Damage Score 0.418 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 93% (64/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that contains a coiled-coil structure and a BTB/POZ domain at its N-terminus, ankyrin repeats in the middle portion, and a FYVE-finger motif at its C-terminus. This protein belongs to a subgroup of double zinc finger proteins which may be involved in vesicle or protein transport. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial embryonic lethality with no apparent neural developmental defects on a mixed genetic background but show complete embryonic lethality on highly homogenous genetic backgrounds. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030C10Rik T C 12: 20,815,459 noncoding transcript Het
Abhd8 A G 8: 71,457,328 V392A probably benign Het
AI481877 T C 4: 59,092,466 I238M probably benign Het
Alpk3 A G 7: 81,078,562 E480G probably benign Het
Aoc3 T G 11: 101,331,752 Y271* probably null Het
Bcl9 T C 3: 97,215,175 I103V probably benign Het
Cgnl1 C T 9: 71,645,487 probably null Het
Cyp2c23 T A 19: 44,021,579 D109V probably damaging Het
Cyp2j13 A T 4: 96,077,432 W13R probably benign Het
D630003M21Rik T C 2: 158,195,580 probably benign Het
Desi2 A T 1: 178,256,495 probably benign Het
Dll3 T C 7: 28,299,009 E177G possibly damaging Het
Ern2 C T 7: 122,179,907 G238D possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm6133 A G 18: 78,350,249 K153E probably benign Het
Gpr68 A T 12: 100,878,821 Y155N probably benign Het
Hcrtr2 T A 9: 76,259,666 I130F probably damaging Het
Hk1 T C 10: 62,286,449 K489R probably benign Het
Ints13 T C 6: 146,555,073 N425S probably damaging Het
Itpkc T C 7: 27,212,988 D578G probably damaging Het
Kcns3 A G 12: 11,092,249 S150P probably benign Het
Khdrbs3 T A 15: 69,049,463 probably null Het
Kif11 A G 19: 37,390,865 I335V probably benign Het
Lrrn4 C G 2: 132,872,156 C290S probably damaging Het
Macrod2 T C 2: 141,232,182 probably benign Het
Mgam A G 6: 40,669,804 N688S probably benign Het
Myh8 G A 11: 67,297,200 E933K probably damaging Het
Nat8f5 T C 6: 85,817,675 Y101C probably damaging Het
Nhlrc1 A G 13: 47,014,712 V23A probably benign Het
Nkx2-3 T A 19: 43,614,533 F193I probably damaging Het
Nlrp4b T A 7: 10,715,487 V172E probably benign Het
Nmrk1 G T 19: 18,645,074 R172S probably benign Het
Nudcd3 T C 11: 6,113,286 D201G probably damaging Het
Olfr1255 T A 2: 89,816,549 D68E probably damaging Het
Olfr1384 A G 11: 49,514,592 E318G unknown Het
Olfr205 A T 16: 59,329,151 Y119* probably null Het
Olfr314 G A 11: 58,786,594 R120H probably benign Het
Olfr46 A G 7: 140,610,943 Y259C probably damaging Het
Olfr679 A T 7: 105,090,895 I248N probably damaging Het
Olfr980 C T 9: 40,006,338 V204I probably benign Het
Oprm1 G A 10: 6,789,026 G51D probably damaging Het
Pcdh15 T A 10: 74,185,345 Y130* probably null Het
Pcdh9 G A 14: 93,886,943 T597I probably damaging Het
Pcdhb19 A G 18: 37,498,037 N295S possibly damaging Het
Pcnx3 T C 19: 5,681,579 probably benign Het
Pdzph1 A T 17: 58,879,151 I1215N probably damaging Het
Phf21a C T 2: 92,351,854 T405I possibly damaging Het
Pkd1l2 C A 8: 117,055,018 G763W probably damaging Het
Prox2 A G 12: 85,087,380 F591L probably benign Het
Robo3 T A 9: 37,419,201 H1033L possibly damaging Het
Sdha A T 13: 74,323,120 C222* probably null Het
Sec16a T C 2: 26,414,390 D2303G probably damaging Het
Slc16a5 A G 11: 115,472,778 K422E possibly damaging Het
Slc22a30 A T 19: 8,386,527 M232K probably damaging Het
Slc35b3 A T 13: 38,937,758 F300I probably damaging Het
Spata2l A G 8: 123,235,720 V34A probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tecta T A 9: 42,345,589 Q1597L possibly damaging Het
Tgfb1i1 A T 7: 128,248,547 probably benign Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tpm3-rs7 A G 14: 113,315,375 T234A probably benign Het
Usp20 A G 2: 31,017,508 Y684C probably damaging Het
Zc3h4 T A 7: 16,429,611 M585K unknown Het
Zfp292 A G 4: 34,806,747 I2099T probably damaging Het
Other mutations in Ankfy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Ankfy1 APN 11 72728772 missense probably benign 0.03
IGL00837:Ankfy1 APN 11 72755898 splice site probably benign
IGL01061:Ankfy1 APN 11 72728860 nonsense probably null
IGL01305:Ankfy1 APN 11 72764791 missense probably damaging 1.00
IGL01599:Ankfy1 APN 11 72738365 missense probably benign
IGL01918:Ankfy1 APN 11 72740455 missense probably benign 0.09
IGL03007:Ankfy1 APN 11 72750521 missense probably damaging 0.98
IGL03134:Ankfy1 APN 11 72712185 missense probably damaging 1.00
IGL03182:Ankfy1 APN 11 72728754
woozy UTSW 11 72754459 missense
ANU22:Ankfy1 UTSW 11 72764791 missense probably damaging 1.00
I2289:Ankfy1 UTSW 11 72730485 missense probably benign 0.01
R0062:Ankfy1 UTSW 11 72712204 missense probably damaging 1.00
R0062:Ankfy1 UTSW 11 72712204 missense probably damaging 1.00
R0569:Ankfy1 UTSW 11 72753608 missense possibly damaging 0.78
R0787:Ankfy1 UTSW 11 72760296 missense probably damaging 1.00
R1303:Ankfy1 UTSW 11 72750071 splice site probably null
R1522:Ankfy1 UTSW 11 72755867 nonsense probably null
R1552:Ankfy1 UTSW 11 72754495 critical splice donor site probably null
R1565:Ankfy1 UTSW 11 72757318 missense probably damaging 1.00
R1899:Ankfy1 UTSW 11 72754407 nonsense probably null
R1900:Ankfy1 UTSW 11 72754407 nonsense probably null
R1950:Ankfy1 UTSW 11 72760329 missense probably damaging 1.00
R2421:Ankfy1 UTSW 11 72755896 splice site probably benign
R3429:Ankfy1 UTSW 11 72712154 splice site probably benign
R3801:Ankfy1 UTSW 11 72749420 missense probably benign
R4079:Ankfy1 UTSW 11 72690009 utr 5 prime probably benign
R4119:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4120:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4165:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4233:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4234:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4236:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4735:Ankfy1 UTSW 11 72730611 missense probably benign
R4765:Ankfy1 UTSW 11 72712291 missense probably benign 0.05
R4904:Ankfy1 UTSW 11 72752105 missense probably benign
R5057:Ankfy1 UTSW 11 72759919 missense probably damaging 1.00
R5454:Ankfy1 UTSW 11 72746931 missense probably benign 0.00
R5471:Ankfy1 UTSW 11 72728791 missense probably benign 0.01
R5737:Ankfy1 UTSW 11 72732274 missense probably damaging 0.98
R5896:Ankfy1 UTSW 11 72759985 missense probably damaging 0.98
R5930:Ankfy1 UTSW 11 72712245 missense probably benign 0.00
R5960:Ankfy1 UTSW 11 72757352 missense possibly damaging 0.91
R6169:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6176:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6177:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6178:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6477:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6513:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6521:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6523:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6524:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TCAGCAGCTTTTGGTTCCG -3'
(R):5'- AAGGTCTACTTGGTTACAGGGATG -3'

Sequencing Primer
(F):5'- CAGCTTTTGGTTCCGTGGTAATTTTG -3'
(R):5'- TGGCCACTGAAGCACTTTAG -3'
Posted On2016-11-21