Incidental Mutation 'R5770:Nhlrc1'
ID446519
Institutional Source Beutler Lab
Gene Symbol Nhlrc1
Ensembl Gene ENSMUSG00000044231
Gene NameNHL repeat containing 1
SynonymsMalin, EPM2B, B230309E09Rik
MMRRC Submission 043370-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R5770 (G1)
Quality Score115
Status Validated
Chromosome13
Chromosomal Location47012557-47014850 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47014712 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 23 (V23A)
Ref Sequence ENSEMBL: ENSMUSP00000054990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052747]
Predicted Effect probably benign
Transcript: ENSMUST00000052747
AA Change: V23A

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000054990
Gene: ENSMUSG00000044231
AA Change: V23A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
RING 28 73 1.45e-6 SMART
low complexity region 89 99 N/A INTRINSIC
low complexity region 101 113 N/A INTRINSIC
internal_repeat_1 128 245 5.99e-5 PROSPERO
internal_repeat_1 263 394 5.99e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000060680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225443
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 93% (64/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single subunit E3 ubiquitin ligase. Laforin is polyubiquitinated by the encoded protein. Defects in this intronless gene lead to an accumulation of laforin and onset of Lafora disease, also known as progressive myoclonic epilepsy type 2 (EPM2).[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of Lafora bodies and total glycogen levels in the heart muscle, skeletal muscle, and brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030C10Rik T C 12: 20,815,459 noncoding transcript Het
Abhd8 A G 8: 71,457,328 V392A probably benign Het
AI481877 T C 4: 59,092,466 I238M probably benign Het
Alpk3 A G 7: 81,078,562 E480G probably benign Het
Ankfy1 C G 11: 72,760,256 H1011D probably damaging Het
Aoc3 T G 11: 101,331,752 Y271* probably null Het
Bcl9 T C 3: 97,215,175 I103V probably benign Het
Cgnl1 C T 9: 71,645,487 probably null Het
Cyp2c23 T A 19: 44,021,579 D109V probably damaging Het
Cyp2j13 A T 4: 96,077,432 W13R probably benign Het
D630003M21Rik T C 2: 158,195,580 probably benign Het
Desi2 A T 1: 178,256,495 probably benign Het
Dll3 T C 7: 28,299,009 E177G possibly damaging Het
Ern2 C T 7: 122,179,907 G238D possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm6133 A G 18: 78,350,249 K153E probably benign Het
Gpr68 A T 12: 100,878,821 Y155N probably benign Het
Hcrtr2 T A 9: 76,259,666 I130F probably damaging Het
Hk1 T C 10: 62,286,449 K489R probably benign Het
Ints13 T C 6: 146,555,073 N425S probably damaging Het
Itpkc T C 7: 27,212,988 D578G probably damaging Het
Kcns3 A G 12: 11,092,249 S150P probably benign Het
Khdrbs3 T A 15: 69,049,463 probably null Het
Kif11 A G 19: 37,390,865 I335V probably benign Het
Lrrn4 C G 2: 132,872,156 C290S probably damaging Het
Macrod2 T C 2: 141,232,182 probably benign Het
Mgam A G 6: 40,669,804 N688S probably benign Het
Myh8 G A 11: 67,297,200 E933K probably damaging Het
Nat8f5 T C 6: 85,817,675 Y101C probably damaging Het
Nkx2-3 T A 19: 43,614,533 F193I probably damaging Het
Nlrp4b T A 7: 10,715,487 V172E probably benign Het
Nmrk1 G T 19: 18,645,074 R172S probably benign Het
Nudcd3 T C 11: 6,113,286 D201G probably damaging Het
Olfr1255 T A 2: 89,816,549 D68E probably damaging Het
Olfr1384 A G 11: 49,514,592 E318G unknown Het
Olfr205 A T 16: 59,329,151 Y119* probably null Het
Olfr314 G A 11: 58,786,594 R120H probably benign Het
Olfr46 A G 7: 140,610,943 Y259C probably damaging Het
Olfr679 A T 7: 105,090,895 I248N probably damaging Het
Olfr980 C T 9: 40,006,338 V204I probably benign Het
Oprm1 G A 10: 6,789,026 G51D probably damaging Het
Pcdh15 T A 10: 74,185,345 Y130* probably null Het
Pcdh9 G A 14: 93,886,943 T597I probably damaging Het
Pcdhb19 A G 18: 37,498,037 N295S possibly damaging Het
Pcnx3 T C 19: 5,681,579 probably benign Het
Pdzph1 A T 17: 58,879,151 I1215N probably damaging Het
Phf21a C T 2: 92,351,854 T405I possibly damaging Het
Pkd1l2 C A 8: 117,055,018 G763W probably damaging Het
Prox2 A G 12: 85,087,380 F591L probably benign Het
Robo3 T A 9: 37,419,201 H1033L possibly damaging Het
Sdha A T 13: 74,323,120 C222* probably null Het
Sec16a T C 2: 26,414,390 D2303G probably damaging Het
Slc16a5 A G 11: 115,472,778 K422E possibly damaging Het
Slc22a30 A T 19: 8,386,527 M232K probably damaging Het
Slc35b3 A T 13: 38,937,758 F300I probably damaging Het
Spata2l A G 8: 123,235,720 V34A probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tecta T A 9: 42,345,589 Q1597L possibly damaging Het
Tgfb1i1 A T 7: 128,248,547 probably benign Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tpm3-rs7 A G 14: 113,315,375 T234A probably benign Het
Usp20 A G 2: 31,017,508 Y684C probably damaging Het
Zc3h4 T A 7: 16,429,611 M585K unknown Het
Zfp292 A G 4: 34,806,747 I2099T probably damaging Het
Other mutations in Nhlrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Nhlrc1 APN 13 47014131 missense probably damaging 0.97
IGL01759:Nhlrc1 APN 13 47013962 missense probably benign 0.00
R1540:Nhlrc1 UTSW 13 47014344 missense probably damaging 1.00
R2116:Nhlrc1 UTSW 13 47014185 missense probably benign 0.00
R4243:Nhlrc1 UTSW 13 47014026 missense probably benign 0.06
R4563:Nhlrc1 UTSW 13 47014190 missense possibly damaging 0.67
R4975:Nhlrc1 UTSW 13 47013740 missense probably benign 0.28
R5100:Nhlrc1 UTSW 13 47014421 missense probably benign
R5671:Nhlrc1 UTSW 13 47013717 missense probably benign 0.06
R6476:Nhlrc1 UTSW 13 47014181 missense possibly damaging 0.95
R6886:Nhlrc1 UTSW 13 47013776 missense possibly damaging 0.94
R7223:Nhlrc1 UTSW 13 47014208 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TCAAAGATCTTGACCCGTCTC -3'
(R):5'- CGTGACGTGATTATCCCAGG -3'

Sequencing Primer
(F):5'- AATCGCTGGTGTCACAGG -3'
(R):5'- GACGTGATTATCCCAGGTCTGC -3'
Posted On2016-11-21