Incidental Mutation 'R5770:Pcdh9'
ID446521
Institutional Source Beutler Lab
Gene Symbol Pcdh9
Ensembl Gene ENSMUSG00000055421
Gene Nameprotocadherin 9
SynonymsC630029H24Rik, A730003J17Rik, C530050I23Rik, LOC382930, 1500001L12Rik
MMRRC Submission 043370-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R5770 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location93013410-93890679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 93886943 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 597 (T597I)
Ref Sequence ENSEMBL: ENSMUSP00000141396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068992] [ENSMUST00000192221] [ENSMUST00000193901] [ENSMUST00000194056] [ENSMUST00000195376] [ENSMUST00000195826]
Predicted Effect probably damaging
Transcript: ENSMUST00000068992
AA Change: T597I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070935
Gene: ENSMUSG00000055421
AA Change: T597I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192221
AA Change: T474I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142260
Gene: ENSMUSG00000055421
AA Change: T474I

DomainStartEndE-ValueType
CA 41 127 1.01e-20 SMART
CA 151 233 2.34e-25 SMART
CA 263 344 2.14e-19 SMART
CA 368 447 4.27e-28 SMART
CA 471 550 2.45e-28 SMART
CA 577 659 1.01e-6 SMART
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 735 760 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192817
Predicted Effect probably damaging
Transcript: ENSMUST00000193901
AA Change: T597I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141759
Gene: ENSMUSG00000055421
AA Change: T597I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194056
AA Change: T597I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141602
Gene: ENSMUSG00000055421
AA Change: T597I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 4.1e-5 SMART
CA 164 250 4.8e-23 SMART
CA 274 356 1.2e-27 SMART
CA 386 467 1.1e-21 SMART
CA 491 570 2e-30 SMART
CA 594 673 1.2e-30 SMART
CA 700 782 4.9e-9 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 860 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194129
Predicted Effect probably damaging
Transcript: ENSMUST00000195376
AA Change: T597I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142224
Gene: ENSMUSG00000055421
AA Change: T597I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 4.1e-5 SMART
CA 164 250 4.8e-23 SMART
CA 274 356 1.2e-27 SMART
CA 386 467 1.1e-21 SMART
CA 491 570 2e-30 SMART
CA 594 673 1.2e-30 SMART
CA 700 782 4.9e-9 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195826
AA Change: T597I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141396
Gene: ENSMUSG00000055421
AA Change: T597I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Meta Mutation Damage Score 0.1364 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 93% (64/69)
MGI Phenotype FUNCTION: This gene encodes a member of the protocadherin family, and cadherin superfamily, of transmembrane proteins containing cadherin domains. These proteins mediate cell adhesion in neural tissues in the presence of calcium. The encoded protein may be involved in signaling at neuronal synaptic junctions. Sharing a characteristic with other protocadherin genes, this gene has a notably large exon that encodes multiple cadherin domains and a transmembrane region. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired long-term social and bject recognition and sensorimotor development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030C10Rik T C 12: 20,815,459 noncoding transcript Het
Abhd8 A G 8: 71,457,328 V392A probably benign Het
AI481877 T C 4: 59,092,466 I238M probably benign Het
Alpk3 A G 7: 81,078,562 E480G probably benign Het
Ankfy1 C G 11: 72,760,256 H1011D probably damaging Het
Aoc3 T G 11: 101,331,752 Y271* probably null Het
Bcl9 T C 3: 97,215,175 I103V probably benign Het
Cgnl1 C T 9: 71,645,487 probably null Het
Cyp2c23 T A 19: 44,021,579 D109V probably damaging Het
Cyp2j13 A T 4: 96,077,432 W13R probably benign Het
D630003M21Rik T C 2: 158,195,580 probably benign Het
Desi2 A T 1: 178,256,495 probably benign Het
Dll3 T C 7: 28,299,009 E177G possibly damaging Het
Ern2 C T 7: 122,179,907 G238D possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm6133 A G 18: 78,350,249 K153E probably benign Het
Gpr68 A T 12: 100,878,821 Y155N probably benign Het
Hcrtr2 T A 9: 76,259,666 I130F probably damaging Het
Hk1 T C 10: 62,286,449 K489R probably benign Het
Ints13 T C 6: 146,555,073 N425S probably damaging Het
Itpkc T C 7: 27,212,988 D578G probably damaging Het
Kcns3 A G 12: 11,092,249 S150P probably benign Het
Khdrbs3 T A 15: 69,049,463 probably null Het
Kif11 A G 19: 37,390,865 I335V probably benign Het
Lrrn4 C G 2: 132,872,156 C290S probably damaging Het
Macrod2 T C 2: 141,232,182 probably benign Het
Mgam A G 6: 40,669,804 N688S probably benign Het
Myh8 G A 11: 67,297,200 E933K probably damaging Het
Nat8f5 T C 6: 85,817,675 Y101C probably damaging Het
Nhlrc1 A G 13: 47,014,712 V23A probably benign Het
Nkx2-3 T A 19: 43,614,533 F193I probably damaging Het
Nlrp4b T A 7: 10,715,487 V172E probably benign Het
Nmrk1 G T 19: 18,645,074 R172S probably benign Het
Nudcd3 T C 11: 6,113,286 D201G probably damaging Het
Olfr1255 T A 2: 89,816,549 D68E probably damaging Het
Olfr1384 A G 11: 49,514,592 E318G unknown Het
Olfr205 A T 16: 59,329,151 Y119* probably null Het
Olfr314 G A 11: 58,786,594 R120H probably benign Het
Olfr46 A G 7: 140,610,943 Y259C probably damaging Het
Olfr679 A T 7: 105,090,895 I248N probably damaging Het
Olfr980 C T 9: 40,006,338 V204I probably benign Het
Oprm1 G A 10: 6,789,026 G51D probably damaging Het
Pcdh15 T A 10: 74,185,345 Y130* probably null Het
Pcdhb19 A G 18: 37,498,037 N295S possibly damaging Het
Pcnx3 T C 19: 5,681,579 probably benign Het
Pdzph1 A T 17: 58,879,151 I1215N probably damaging Het
Phf21a C T 2: 92,351,854 T405I possibly damaging Het
Pkd1l2 C A 8: 117,055,018 G763W probably damaging Het
Prox2 A G 12: 85,087,380 F591L probably benign Het
Robo3 T A 9: 37,419,201 H1033L possibly damaging Het
Sdha A T 13: 74,323,120 C222* probably null Het
Sec16a T C 2: 26,414,390 D2303G probably damaging Het
Slc16a5 A G 11: 115,472,778 K422E possibly damaging Het
Slc22a30 A T 19: 8,386,527 M232K probably damaging Het
Slc35b3 A T 13: 38,937,758 F300I probably damaging Het
Spata2l A G 8: 123,235,720 V34A probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tecta T A 9: 42,345,589 Q1597L possibly damaging Het
Tgfb1i1 A T 7: 128,248,547 probably benign Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tpm3-rs7 A G 14: 113,315,375 T234A probably benign Het
Usp20 A G 2: 31,017,508 Y684C probably damaging Het
Zc3h4 T A 7: 16,429,611 M585K unknown Het
Zfp292 A G 4: 34,806,747 I2099T probably damaging Het
Other mutations in Pcdh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Pcdh9 APN 14 93326694 missense probably damaging 1.00
IGL02183:Pcdh9 APN 14 93886284 missense probably benign 0.01
IGL02244:Pcdh9 APN 14 93326768 missense probably damaging 1.00
IGL02571:Pcdh9 APN 14 93560587 splice site probably benign
IGL03018:Pcdh9 APN 14 93015576 missense probably null
I1329:Pcdh9 UTSW 14 93886209 missense probably benign 0.00
R0027:Pcdh9 UTSW 14 93888645 missense probably null 0.99
R0027:Pcdh9 UTSW 14 93888645 missense probably null 0.99
R0477:Pcdh9 UTSW 14 93887678 missense probably damaging 0.99
R0499:Pcdh9 UTSW 14 93886235 missense probably damaging 1.00
R0787:Pcdh9 UTSW 14 93886757 missense possibly damaging 0.88
R1205:Pcdh9 UTSW 14 93886065 missense probably benign 0.01
R1616:Pcdh9 UTSW 14 93886969 nonsense probably null
R1620:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1622:Pcdh9 UTSW 14 93885875 missense probably benign 0.03
R1708:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1721:Pcdh9 UTSW 14 93888035 missense probably damaging 1.00
R1753:Pcdh9 UTSW 14 93887225 missense probably benign 0.33
R1799:Pcdh9 UTSW 14 93888671 missense probably benign 0.36
R1867:Pcdh9 UTSW 14 93888035 missense probably damaging 1.00
R1987:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1988:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R2444:Pcdh9 UTSW 14 93886791 missense probably benign 0.10
R3895:Pcdh9 UTSW 14 93887538 missense probably damaging 1.00
R3926:Pcdh9 UTSW 14 93886810 nonsense probably null
R4166:Pcdh9 UTSW 14 93887520 nonsense probably null
R4429:Pcdh9 UTSW 14 93887384 missense probably damaging 0.96
R4589:Pcdh9 UTSW 14 93888192 missense probably damaging 1.00
R4604:Pcdh9 UTSW 14 93887180 missense probably damaging 1.00
R4607:Pcdh9 UTSW 14 93015573 missense probably benign 0.08
R4621:Pcdh9 UTSW 14 93887643 missense probably benign 0.12
R4624:Pcdh9 UTSW 14 93886409 missense probably damaging 1.00
R4712:Pcdh9 UTSW 14 93888631 missense probably damaging 1.00
R4788:Pcdh9 UTSW 14 93887415 missense probably damaging 1.00
R4831:Pcdh9 UTSW 14 93887941 missense probably damaging 1.00
R4883:Pcdh9 UTSW 14 93888728 missense possibly damaging 0.83
R5034:Pcdh9 UTSW 14 93326849 missense probably benign 0.13
R5175:Pcdh9 UTSW 14 93888443 missense probably damaging 1.00
R5637:Pcdh9 UTSW 14 93885762 missense possibly damaging 0.91
R5743:Pcdh9 UTSW 14 93886724 missense probably damaging 1.00
R5753:Pcdh9 UTSW 14 93888161 missense probably damaging 1.00
R5900:Pcdh9 UTSW 14 93326720 missense probably damaging 0.98
R5986:Pcdh9 UTSW 14 93887048 missense probably damaging 1.00
R6052:Pcdh9 UTSW 14 93885846 missense probably benign 0.40
R6113:Pcdh9 UTSW 14 93887108 missense probably damaging 1.00
R6223:Pcdh9 UTSW 14 93015733 missense probably benign 0.18
R6415:Pcdh9 UTSW 14 93015842 missense possibly damaging 0.83
R6435:Pcdh9 UTSW 14 93887844 missense probably benign 0.01
R7064:Pcdh9 UTSW 14 93886149 missense probably damaging 1.00
R7143:Pcdh9 UTSW 14 93888272 missense probably damaging 0.99
R7219:Pcdh9 UTSW 14 93015780 missense possibly damaging 0.87
R7262:Pcdh9 UTSW 14 93015705 missense probably benign 0.01
R7354:Pcdh9 UTSW 14 93888270 missense probably benign 0.28
R7369:Pcdh9 UTSW 14 93886367 missense possibly damaging 0.67
R7427:Pcdh9 UTSW 14 93887111 missense probably damaging 1.00
R7428:Pcdh9 UTSW 14 93887111 missense probably damaging 1.00
R7780:Pcdh9 UTSW 14 93886551 missense possibly damaging 0.91
R7870:Pcdh9 UTSW 14 93887257 missense probably damaging 0.97
R7921:Pcdh9 UTSW 14 93015565 missense probably benign
R8052:Pcdh9 UTSW 14 93885786 missense probably benign 0.00
R8252:Pcdh9 UTSW 14 93888650 missense probably damaging 1.00
X0012:Pcdh9 UTSW 14 93886644 missense possibly damaging 0.71
X0067:Pcdh9 UTSW 14 93326849 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CTTTTGCAGTAGAGGACCGTG -3'
(R):5'- TCCAGAGTCTTTAACAGGGAGG -3'

Sequencing Primer
(F):5'- TAGAGGACCGTGGTGGC -3'
(R):5'- CGGTTCATTTTTACAGTAACTGCCAG -3'
Posted On2016-11-21