Incidental Mutation 'R5770:Kif11'
ID446531
Institutional Source Beutler Lab
Gene Symbol Kif11
Ensembl Gene ENSMUSG00000012443
Gene Namekinesin family member 11
SynonymsEg5, Knsl1, Kifl1
MMRRC Submission 043370-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5770 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location37376403-37421859 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37390865 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 335 (I335V)
Ref Sequence ENSEMBL: ENSMUSP00000012587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012587]
Predicted Effect probably benign
Transcript: ENSMUST00000012587
AA Change: I335V

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000012587
Gene: ENSMUSG00000012443
AA Change: I335V

DomainStartEndE-ValueType
KISc 15 366 8.21e-180 SMART
Blast:KISc 372 417 1e-16 BLAST
low complexity region 453 465 N/A INTRINSIC
Pfam:Microtub_bind 915 1049 1.2e-44 PFAM
Meta Mutation Damage Score 0.1096 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 93% (64/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that belongs to the kinesin-like protein family. Members of this protein family are known to be involved in various kinds of spindle dynamics. The function of this gene product includes chromosome positioning, centrosome separation and establishing a bipolar spindle during cell mitosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Deletion of Kif11 results in early embryonic lethality of homozygotes, with developmental growth arrest at E3.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030C10Rik T C 12: 20,815,459 noncoding transcript Het
Abhd8 A G 8: 71,457,328 V392A probably benign Het
AI481877 T C 4: 59,092,466 I238M probably benign Het
Alpk3 A G 7: 81,078,562 E480G probably benign Het
Ankfy1 C G 11: 72,760,256 H1011D probably damaging Het
Aoc3 T G 11: 101,331,752 Y271* probably null Het
Bcl9 T C 3: 97,215,175 I103V probably benign Het
Cgnl1 C T 9: 71,645,487 probably null Het
Cyp2c23 T A 19: 44,021,579 D109V probably damaging Het
Cyp2j13 A T 4: 96,077,432 W13R probably benign Het
D630003M21Rik T C 2: 158,195,580 probably benign Het
Desi2 A T 1: 178,256,495 probably benign Het
Dll3 T C 7: 28,299,009 E177G possibly damaging Het
Ern2 C T 7: 122,179,907 G238D possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm6133 A G 18: 78,350,249 K153E probably benign Het
Gpr68 A T 12: 100,878,821 Y155N probably benign Het
Hcrtr2 T A 9: 76,259,666 I130F probably damaging Het
Hk1 T C 10: 62,286,449 K489R probably benign Het
Ints13 T C 6: 146,555,073 N425S probably damaging Het
Itpkc T C 7: 27,212,988 D578G probably damaging Het
Kcns3 A G 12: 11,092,249 S150P probably benign Het
Khdrbs3 T A 15: 69,049,463 probably null Het
Lrrn4 C G 2: 132,872,156 C290S probably damaging Het
Macrod2 T C 2: 141,232,182 probably benign Het
Mgam A G 6: 40,669,804 N688S probably benign Het
Myh8 G A 11: 67,297,200 E933K probably damaging Het
Nat8f5 T C 6: 85,817,675 Y101C probably damaging Het
Nhlrc1 A G 13: 47,014,712 V23A probably benign Het
Nkx2-3 T A 19: 43,614,533 F193I probably damaging Het
Nlrp4b T A 7: 10,715,487 V172E probably benign Het
Nmrk1 G T 19: 18,645,074 R172S probably benign Het
Nudcd3 T C 11: 6,113,286 D201G probably damaging Het
Olfr1255 T A 2: 89,816,549 D68E probably damaging Het
Olfr1384 A G 11: 49,514,592 E318G unknown Het
Olfr205 A T 16: 59,329,151 Y119* probably null Het
Olfr314 G A 11: 58,786,594 R120H probably benign Het
Olfr46 A G 7: 140,610,943 Y259C probably damaging Het
Olfr679 A T 7: 105,090,895 I248N probably damaging Het
Olfr980 C T 9: 40,006,338 V204I probably benign Het
Oprm1 G A 10: 6,789,026 G51D probably damaging Het
Pcdh15 T A 10: 74,185,345 Y130* probably null Het
Pcdh9 G A 14: 93,886,943 T597I probably damaging Het
Pcdhb19 A G 18: 37,498,037 N295S possibly damaging Het
Pcnx3 T C 19: 5,681,579 probably benign Het
Pdzph1 A T 17: 58,879,151 I1215N probably damaging Het
Phf21a C T 2: 92,351,854 T405I possibly damaging Het
Pkd1l2 C A 8: 117,055,018 G763W probably damaging Het
Prox2 A G 12: 85,087,380 F591L probably benign Het
Robo3 T A 9: 37,419,201 H1033L possibly damaging Het
Sdha A T 13: 74,323,120 C222* probably null Het
Sec16a T C 2: 26,414,390 D2303G probably damaging Het
Slc16a5 A G 11: 115,472,778 K422E possibly damaging Het
Slc22a30 A T 19: 8,386,527 M232K probably damaging Het
Slc35b3 A T 13: 38,937,758 F300I probably damaging Het
Spata2l A G 8: 123,235,720 V34A probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tecta T A 9: 42,345,589 Q1597L possibly damaging Het
Tgfb1i1 A T 7: 128,248,547 probably benign Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tpm3-rs7 A G 14: 113,315,375 T234A probably benign Het
Usp20 A G 2: 31,017,508 Y684C probably damaging Het
Zc3h4 T A 7: 16,429,611 M585K unknown Het
Zfp292 A G 4: 34,806,747 I2099T probably damaging Het
Other mutations in Kif11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Kif11 APN 19 37411409 missense possibly damaging 0.82
IGL00785:Kif11 APN 19 37404297 missense probably benign 0.01
IGL00785:Kif11 APN 19 37404298 missense probably damaging 0.99
IGL01586:Kif11 APN 19 37384233 splice site probably benign
IGL01883:Kif11 APN 19 37384343 missense probably benign 0.01
IGL02138:Kif11 APN 19 37384609 missense probably damaging 1.00
IGL03197:Kif11 APN 19 37407027 missense probably benign 0.00
PIT4151001:Kif11 UTSW 19 37384597 missense probably damaging 1.00
R0027:Kif11 UTSW 19 37406983 splice site probably benign
R0027:Kif11 UTSW 19 37406983 splice site probably benign
R0104:Kif11 UTSW 19 37413215 missense probably benign 0.00
R0254:Kif11 UTSW 19 37411509 missense probably benign 0.00
R0631:Kif11 UTSW 19 37413117 splice site probably benign
R1607:Kif11 UTSW 19 37387200 nonsense probably null
R1895:Kif11 UTSW 19 37387399 missense probably damaging 1.00
R1983:Kif11 UTSW 19 37390776 missense possibly damaging 0.78
R2056:Kif11 UTSW 19 37402212 missense probably benign 0.17
R2158:Kif11 UTSW 19 37410614 missense probably benign
R2291:Kif11 UTSW 19 37407003 missense probably benign
R2300:Kif11 UTSW 19 37411539 missense probably benign 0.01
R2850:Kif11 UTSW 19 37409493 missense probably benign
R2904:Kif11 UTSW 19 37403655 splice site probably benign
R3035:Kif11 UTSW 19 37407053 missense possibly damaging 0.92
R3908:Kif11 UTSW 19 37390721 missense probably damaging 1.00
R4319:Kif11 UTSW 19 37384585 missense probably damaging 0.99
R4356:Kif11 UTSW 19 37411435 missense probably benign 0.00
R4469:Kif11 UTSW 19 37416492 missense probably benign 0.05
R4623:Kif11 UTSW 19 37409747 missense probably benign
R4779:Kif11 UTSW 19 37417949 missense probably benign 0.00
R4911:Kif11 UTSW 19 37417937 missense probably benign 0.00
R4980:Kif11 UTSW 19 37387371 nonsense probably null
R5109:Kif11 UTSW 19 37384615 missense possibly damaging 0.81
R6023:Kif11 UTSW 19 37390710 missense probably damaging 1.00
R6666:Kif11 UTSW 19 37409766 missense probably benign
R6755:Kif11 UTSW 19 37409751 missense probably benign 0.01
R6845:Kif11 UTSW 19 37404117 missense probably damaging 1.00
R7052:Kif11 UTSW 19 37384592 nonsense probably null
R7367:Kif11 UTSW 19 37420341 missense probably benign
R7387:Kif11 UTSW 19 37409756 missense probably damaging 1.00
R7485:Kif11 UTSW 19 37410624 missense possibly damaging 0.94
R7502:Kif11 UTSW 19 37409807 missense possibly damaging 0.53
R7591:Kif11 UTSW 19 37384263 missense probably damaging 1.00
R7618:Kif11 UTSW 19 37411560 missense probably benign 0.32
R7809:Kif11 UTSW 19 37384609 missense probably damaging 1.00
R8181:Kif11 UTSW 19 37390647 critical splice acceptor site probably null
R8274:Kif11 UTSW 19 37403546 missense probably damaging 0.99
R8323:Kif11 UTSW 19 37384244 missense possibly damaging 0.77
Z1177:Kif11 UTSW 19 37413287 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CATCAACTAGCTTTGAAGTGGGAG -3'
(R):5'- CTACTTTGGAAGTCATAACTGGC -3'

Sequencing Primer
(F):5'- AAAATATTGGGCGTTCTGGAGC -3'
(R):5'- ACTGGCTTTTTATTGTACCAGATTG -3'
Posted On2016-11-21