Incidental Mutation 'R5699:Rc3h1'
ID446540
Institutional Source Beutler Lab
Gene Symbol Rc3h1
Ensembl Gene ENSMUSG00000040423
Gene NameRING CCCH (C3H) domains 1
Synonymsroquin, 5730557L09Rik
MMRRC Submission 043327-MU
Accession Numbers

Genbank: NM_001024952; MGI: 2685397

Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R5699 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location160906418-160974978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 160930253 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 47 (R47L)
Ref Sequence ENSEMBL: ENSMUSP00000037178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035911] [ENSMUST00000161609]
Predicted Effect probably damaging
Transcript: ENSMUST00000035911
AA Change: R47L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037178
Gene: ENSMUSG00000040423
AA Change: R47L

DomainStartEndE-ValueType
RING 14 53 5.9e-8 SMART
low complexity region 201 212 N/A INTRINSIC
Pfam:zf-CCCH 414 440 1.4e-4 PFAM
low complexity region 551 562 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 728 750 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
coiled coil region 954 983 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161609
AA Change: R47L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124871
Gene: ENSMUSG00000040423
AA Change: R47L

DomainStartEndE-ValueType
RING 14 53 1.25e-5 SMART
low complexity region 201 212 N/A INTRINSIC
Pfam:zf-CCCH 414 440 5.3e-7 PFAM
low complexity region 551 562 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 728 750 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
coiled coil region 954 983 N/A INTRINSIC
low complexity region 1003 1011 N/A INTRINSIC
low complexity region 1093 1107 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing RING-type and C3H1-type zinc finger motifs. The encoded protein recognizes and binds to a constitutive decay element (CDE) in the 3' UTR of mRNAs, leading to mRNA deadenylation and degradation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: A single recessive mutation on this gene resulted in severe autoimmune disease with phenotype resembling human systemic lupus erythematosus. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(5) Chemically induced(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,225,319 noncoding transcript Het
4930486L24Rik A G 13: 60,853,596 F106L possibly damaging Het
Adam11 A T 11: 102,773,640 M385L probably benign Het
Adgre1 C T 17: 57,481,007 P925S probably benign Het
Adh7 G A 3: 138,226,326 A234T probably benign Het
Ano2 A G 6: 125,872,740 E475G probably damaging Het
BC055324 A T 1: 163,957,551 V753D probably benign Het
C2cd4c A G 10: 79,612,551 V254A probably benign Het
Car13 A G 3: 14,650,689 Y89C probably damaging Het
Cd38 A G 5: 43,900,386 K100R probably damaging Het
Cdh11 A G 8: 102,634,543 I721T probably damaging Het
Cdh2 G A 18: 16,646,522 Q161* probably null Het
Clk1 T C 1: 58,420,195 K135R probably damaging Het
Col5a1 G A 2: 27,997,599 G961R unknown Het
Cpt1b T A 15: 89,424,273 I151F probably benign Het
Cyp51 A G 5: 4,101,213 F139L probably damaging Het
Disp1 TTGA T 1: 183,088,555 probably null Het
Dnah8 T C 17: 30,810,324 I4089T probably benign Het
Dnali1 C T 4: 125,059,050 V227M possibly damaging Het
Eml4 T G 17: 83,410,085 S29A probably benign Het
Eps8l3 C A 3: 107,879,579 P24T probably benign Het
Fancc A T 13: 63,330,632 probably null Het
Grid2 G A 6: 63,908,991 A124T probably damaging Het
Ikbke C T 1: 131,276,467 probably null Het
Kyat1 G A 2: 30,186,650 A284V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmbrd2 G T 15: 9,175,182 L393F probably benign Het
Lrrc26 T A 2: 25,290,524 L179Q probably damaging Het
Mlx A G 11: 101,088,694 D113G possibly damaging Het
Myod1 A G 7: 46,376,983 K104R probably damaging Het
Nwd1 G A 8: 72,702,974 probably null Het
Olfr1474 A G 19: 13,470,972 M1V probably null Het
Olfr663 T G 7: 104,703,993 V142G probably damaging Het
Olfr788 A C 10: 129,472,877 N62H probably damaging Het
Pacsin3 A T 2: 91,262,781 Y206F probably damaging Het
Pcdhgb5 T A 18: 37,731,917 V255E probably damaging Het
Pdp1 T C 4: 11,960,907 D468G possibly damaging Het
Pgr C T 9: 8,900,599 probably benign Het
Prrt2 T A 7: 127,018,727 Y345F probably benign Het
Rbbp8nl T C 2: 180,278,668 T515A probably damaging Het
Rfpl4b T A 10: 38,821,285 I107F possibly damaging Het
Rsbn1 T C 3: 103,962,485 F754S probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn3a T C 2: 65,507,264 T630A possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slco1a5 C A 6: 142,248,816 C367F probably damaging Het
Slit1 A G 19: 41,625,520 probably null Het
Slit2 G A 5: 48,220,991 probably null Het
Snrnp40 G T 4: 130,365,165 G122V possibly damaging Het
Stk16 T A 1: 75,213,604 M111K probably damaging Het
Tbc1d2 T C 4: 46,616,298 I477V probably benign Het
Tll1 T A 8: 64,117,940 E199D probably damaging Het
Trhde A T 10: 114,588,502 D459E probably benign Het
Ttn T C 2: 76,711,537 R25375G possibly damaging Het
Tubgcp2 A T 7: 139,998,788 M757K possibly damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ubqln5 A G 7: 104,129,425 V64A possibly damaging Het
Usp47 A G 7: 112,109,997 M1337V probably benign Het
Vmn1r201 T A 13: 22,475,239 Y208N probably damaging Het
Xkr8 C T 4: 132,728,057 R335H probably damaging Het
Zbtb49 A T 5: 38,216,526 C25S probably damaging Het
Zeb2 T A 2: 44,997,788 N404I probably damaging Het
Other mutations in Rc3h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
sanroque APN 1 160940830 synonymous probably benign
IGL00417:Rc3h1 APN 1 160955981 critical splice donor site probably null
IGL02302:Rc3h1 APN 1 160938105 splice site probably benign
IGL03053:Rc3h1 APN 1 160955817 missense probably benign
IGL03275:Rc3h1 APN 1 160959555 critical splice donor site probably null
curlyfry UTSW 1 160959399 critical splice acceptor site probably null
PIT4651001:Rc3h1 UTSW 1 160963540 missense probably benign 0.04
R0528:Rc3h1 UTSW 1 160967658 missense probably damaging 1.00
R0609:Rc3h1 UTSW 1 160930135 missense probably damaging 1.00
R1620:Rc3h1 UTSW 1 160954973 missense probably benign 0.02
R1661:Rc3h1 UTSW 1 160959423 missense probably benign 0.29
R1665:Rc3h1 UTSW 1 160959423 missense probably benign 0.29
R2027:Rc3h1 UTSW 1 160954937 missense probably benign 0.03
R2145:Rc3h1 UTSW 1 160930257 missense probably damaging 1.00
R2207:Rc3h1 UTSW 1 160940025 missense probably damaging 0.97
R2227:Rc3h1 UTSW 1 160963542 missense probably benign 0.07
R2348:Rc3h1 UTSW 1 160950860 missense probably damaging 1.00
R2925:Rc3h1 UTSW 1 160954976 missense probably damaging 1.00
R3977:Rc3h1 UTSW 1 160959399 critical splice acceptor site probably null
R5071:Rc3h1 UTSW 1 160959477 missense possibly damaging 0.76
R5177:Rc3h1 UTSW 1 160951652 missense probably damaging 1.00
R5410:Rc3h1 UTSW 1 160964963 missense possibly damaging 0.47
R5421:Rc3h1 UTSW 1 160951830 critical splice donor site probably null
R5873:Rc3h1 UTSW 1 160959501 missense probably damaging 0.99
R7672:Rc3h1 UTSW 1 160950884 missense probably damaging 0.99
R8163:Rc3h1 UTSW 1 160955059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGTGGAATCTTTGCTTTAGA -3'
(R):5'- ATAGCTGTATCTTTGTGTTTTCCATT -3'

Sequencing Primer
(F):5'- GTGTGTGTGTGTGCGTGTTAG -3'
(R):5'- GACACTCCATGCTCATTTTAAGGAC -3'
Posted On2016-11-21