Incidental Mutation 'R5699:Snrnp40'
ID446557
Institutional Source Beutler Lab
Gene Symbol Snrnp40
Ensembl Gene ENSMUSG00000074088
Gene Namesmall nuclear ribonucleoprotein 40 (U5)
Synonyms0610009C03Rik, Wdr57
MMRRC Submission 043327-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5699 (G1)
Quality Score159
Status Not validated
Chromosome4
Chromosomal Location130360132-130390026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 130365165 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 122 (G122V)
Ref Sequence ENSEMBL: ENSMUSP00000101616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105994]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105994
AA Change: G122V

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101616
Gene: ENSMUSG00000074088
AA Change: G122V

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
WD40 56 95 1.64e-9 SMART
WD40 99 138 1.83e-7 SMART
WD40 141 181 8.68e-9 SMART
WD40 184 222 3.81e-5 SMART
WD40 225 264 3.24e-8 SMART
WD40 271 314 5.1e-6 SMART
WD40 317 356 2.84e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181161
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the U5 small nuclear ribonucleoprotein (snRNP) particle. The U5 snRNP is part of the spliceosome, a multiprotein complex that catalyzes the removal of introns from pre-messenger RNAs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,225,319 noncoding transcript Het
4930486L24Rik A G 13: 60,853,596 F106L possibly damaging Het
Adam11 A T 11: 102,773,640 M385L probably benign Het
Adgre1 C T 17: 57,481,007 P925S probably benign Het
Adh7 G A 3: 138,226,326 A234T probably benign Het
Ano2 A G 6: 125,872,740 E475G probably damaging Het
BC055324 A T 1: 163,957,551 V753D probably benign Het
C2cd4c A G 10: 79,612,551 V254A probably benign Het
Car13 A G 3: 14,650,689 Y89C probably damaging Het
Cd38 A G 5: 43,900,386 K100R probably damaging Het
Cdh11 A G 8: 102,634,543 I721T probably damaging Het
Cdh2 G A 18: 16,646,522 Q161* probably null Het
Clk1 T C 1: 58,420,195 K135R probably damaging Het
Col5a1 G A 2: 27,997,599 G961R unknown Het
Cpt1b T A 15: 89,424,273 I151F probably benign Het
Cyp51 A G 5: 4,101,213 F139L probably damaging Het
Disp1 TTGA T 1: 183,088,555 probably null Het
Dnah8 T C 17: 30,810,324 I4089T probably benign Het
Dnali1 C T 4: 125,059,050 V227M possibly damaging Het
Eml4 T G 17: 83,410,085 S29A probably benign Het
Eps8l3 C A 3: 107,879,579 P24T probably benign Het
Fancc A T 13: 63,330,632 probably null Het
Grid2 G A 6: 63,908,991 A124T probably damaging Het
Ikbke C T 1: 131,276,467 probably null Het
Kyat1 G A 2: 30,186,650 A284V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmbrd2 G T 15: 9,175,182 L393F probably benign Het
Lrrc26 T A 2: 25,290,524 L179Q probably damaging Het
Mlx A G 11: 101,088,694 D113G possibly damaging Het
Myod1 A G 7: 46,376,983 K104R probably damaging Het
Nwd1 G A 8: 72,702,974 probably null Het
Olfr1474 A G 19: 13,470,972 M1V probably null Het
Olfr663 T G 7: 104,703,993 V142G probably damaging Het
Olfr788 A C 10: 129,472,877 N62H probably damaging Het
Pacsin3 A T 2: 91,262,781 Y206F probably damaging Het
Pcdhgb5 T A 18: 37,731,917 V255E probably damaging Het
Pdp1 T C 4: 11,960,907 D468G possibly damaging Het
Pgr C T 9: 8,900,599 probably benign Het
Prrt2 T A 7: 127,018,727 Y345F probably benign Het
Rbbp8nl T C 2: 180,278,668 T515A probably damaging Het
Rc3h1 G T 1: 160,930,253 R47L probably damaging Het
Rfpl4b T A 10: 38,821,285 I107F possibly damaging Het
Rsbn1 T C 3: 103,962,485 F754S probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn3a T C 2: 65,507,264 T630A possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slco1a5 C A 6: 142,248,816 C367F probably damaging Het
Slit1 A G 19: 41,625,520 probably null Het
Slit2 G A 5: 48,220,991 probably null Het
Stk16 T A 1: 75,213,604 M111K probably damaging Het
Tbc1d2 T C 4: 46,616,298 I477V probably benign Het
Tll1 T A 8: 64,117,940 E199D probably damaging Het
Trhde A T 10: 114,588,502 D459E probably benign Het
Ttn T C 2: 76,711,537 R25375G possibly damaging Het
Tubgcp2 A T 7: 139,998,788 M757K possibly damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ubqln5 A G 7: 104,129,425 V64A possibly damaging Het
Usp47 A G 7: 112,109,997 M1337V probably benign Het
Vmn1r201 T A 13: 22,475,239 Y208N probably damaging Het
Xkr8 C T 4: 132,728,057 R335H probably damaging Het
Zbtb49 A T 5: 38,216,526 C25S probably damaging Het
Zeb2 T A 2: 44,997,788 N404I probably damaging Het
Other mutations in Snrnp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02200:Snrnp40 APN 4 130360221 missense probably damaging 0.99
IGL02306:Snrnp40 APN 4 130365100 missense probably benign 0.21
skywarp UTSW 4 130378043 splice site probably null
R0027:Snrnp40 UTSW 4 130368273 missense probably damaging 1.00
R0027:Snrnp40 UTSW 4 130368273 missense probably damaging 1.00
R0077:Snrnp40 UTSW 4 130378043 splice site probably null
R0134:Snrnp40 UTSW 4 130378043 splice site probably null
R0211:Snrnp40 UTSW 4 130378043 splice site probably null
R0349:Snrnp40 UTSW 4 130378043 splice site probably null
R0371:Snrnp40 UTSW 4 130378043 splice site probably null
R0372:Snrnp40 UTSW 4 130378043 splice site probably null
R0376:Snrnp40 UTSW 4 130378043 splice site probably null
R0377:Snrnp40 UTSW 4 130378043 splice site probably null
R0400:Snrnp40 UTSW 4 130362650 missense probably damaging 1.00
R0442:Snrnp40 UTSW 4 130378043 splice site probably null
R0443:Snrnp40 UTSW 4 130378043 splice site probably null
R0486:Snrnp40 UTSW 4 130378043 splice site probably null
R0488:Snrnp40 UTSW 4 130378043 splice site probably null
R0568:Snrnp40 UTSW 4 130378043 splice site probably null
R0624:Snrnp40 UTSW 4 130362658 missense probably damaging 0.98
R0632:Snrnp40 UTSW 4 130378043 splice site probably null
R0650:Snrnp40 UTSW 4 130378043 splice site probably null
R0733:Snrnp40 UTSW 4 130378043 splice site probably null
R1161:Snrnp40 UTSW 4 130378043 splice site probably null
R1182:Snrnp40 UTSW 4 130378043 splice site probably null
R1234:Snrnp40 UTSW 4 130378043 splice site probably null
R1236:Snrnp40 UTSW 4 130378043 splice site probably null
R1305:Snrnp40 UTSW 4 130378043 splice site probably null
R1308:Snrnp40 UTSW 4 130378043 splice site probably null
R1333:Snrnp40 UTSW 4 130378043 splice site probably null
R1413:Snrnp40 UTSW 4 130378043 splice site probably null
R1569:Snrnp40 UTSW 4 130378043 splice site probably null
R1616:Snrnp40 UTSW 4 130378043 splice site probably null
R1656:Snrnp40 UTSW 4 130378043 splice site probably null
R1675:Snrnp40 UTSW 4 130378043 splice site probably null
R1759:Snrnp40 UTSW 4 130378043 splice site probably null
R1856:Snrnp40 UTSW 4 130378043 splice site probably null
R1901:Snrnp40 UTSW 4 130385975 missense probably damaging 0.98
R1912:Snrnp40 UTSW 4 130378043 splice site probably null
R1930:Snrnp40 UTSW 4 130378043 splice site probably null
R1931:Snrnp40 UTSW 4 130378043 splice site probably null
R2435:Snrnp40 UTSW 4 130384551 missense probably damaging 1.00
R3722:Snrnp40 UTSW 4 130368275 missense possibly damaging 0.76
R4782:Snrnp40 UTSW 4 130362756 missense probably damaging 1.00
R4799:Snrnp40 UTSW 4 130362756 missense probably damaging 1.00
R5075:Snrnp40 UTSW 4 130388582 missense probably benign 0.07
R5104:Snrnp40 UTSW 4 130365165 missense possibly damaging 0.78
R5369:Snrnp40 UTSW 4 130362646 missense probably damaging 0.97
R7529:Snrnp40 UTSW 4 130384482 missense possibly damaging 0.94
R8264:Snrnp40 UTSW 4 130378074 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAACCAGTGTTGTGCCATG -3'
(R):5'- ATGTCTCATGAACGGGCTGC -3'

Sequencing Primer
(F):5'- TGCCATGGGTATATAATTTCGAAAAG -3'
(R):5'- GTGGGCCTCAAAACTGTGCTTC -3'
Posted On2016-11-21