Incidental Mutation 'R5699:Zbtb49'
ID446561
Institutional Source Beutler Lab
Gene Symbol Zbtb49
Ensembl Gene ENSMUSG00000029127
Gene Namezinc finger and BTB domain containing 49
SynonymsZfp509, 4930518A03Rik
MMRRC Submission 043327-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5699 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location38189735-38220457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38216526 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 25 (C25S)
Ref Sequence ENSEMBL: ENSMUSP00000117913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087514] [ENSMUST00000094833] [ENSMUST00000114106] [ENSMUST00000114113] [ENSMUST00000123106] [ENSMUST00000123207] [ENSMUST00000126267] [ENSMUST00000130721] [ENSMUST00000132190] [ENSMUST00000136475] [ENSMUST00000138820] [ENSMUST00000143436] [ENSMUST00000155300] [ENSMUST00000202506] [ENSMUST00000152066] [ENSMUST00000154975]
Predicted Effect probably benign
Transcript: ENSMUST00000087514
SMART Domains Protein: ENSMUSP00000084791
Gene: ENSMUSG00000067367

DomainStartEndE-ValueType
Pfam:zf-LYAR 31 58 1.7e-18 PFAM
low complexity region 138 152 N/A INTRINSIC
coiled coil region 174 216 N/A INTRINSIC
low complexity region 225 247 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094833
AA Change: C25S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092429
Gene: ENSMUSG00000029127
AA Change: C25S

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
ZnF_C2H2 414 436 6.99e-5 SMART
ZnF_C2H2 442 464 2.24e-3 SMART
ZnF_C2H2 470 492 1.26e-2 SMART
ZnF_C2H2 498 520 5.14e-3 SMART
ZnF_C2H2 526 548 2.27e-4 SMART
ZnF_C2H2 554 576 3.39e-3 SMART
low complexity region 597 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114106
SMART Domains Protein: ENSMUSP00000109741
Gene: ENSMUSG00000067367

DomainStartEndE-ValueType
Pfam:zf-LYAR 31 58 4.3e-18 PFAM
low complexity region 138 152 N/A INTRINSIC
coiled coil region 174 216 N/A INTRINSIC
low complexity region 225 247 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114113
AA Change: C25S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109748
Gene: ENSMUSG00000029127
AA Change: C25S

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
low complexity region 413 430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123106
AA Change: C25S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144200
Gene: ENSMUSG00000029127
AA Change: C25S

DomainStartEndE-ValueType
Pfam:BTB 12 51 1.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123207
SMART Domains Protein: ENSMUSP00000121204
Gene: ENSMUSG00000067367

DomainStartEndE-ValueType
Pfam:zf-LYAR 31 58 8e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126267
AA Change: C25S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122109
Gene: ENSMUSG00000029127
AA Change: C25S

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129161
Predicted Effect probably benign
Transcript: ENSMUST00000130721
SMART Domains Protein: ENSMUSP00000122153
Gene: ENSMUSG00000067367

DomainStartEndE-ValueType
Pfam:zf-LYAR 31 58 2.4e-17 PFAM
low complexity region 138 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132190
SMART Domains Protein: ENSMUSP00000121320
Gene: ENSMUSG00000067367

DomainStartEndE-ValueType
Pfam:zf-LYAR 31 58 2.4e-17 PFAM
low complexity region 138 152 N/A INTRINSIC
low complexity region 180 191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136475
AA Change: C25S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117174
Gene: ENSMUSG00000029127
AA Change: C25S

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137577
Predicted Effect probably damaging
Transcript: ENSMUST00000138820
AA Change: C25S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117913
Gene: ENSMUSG00000029127
AA Change: C25S

DomainStartEndE-ValueType
Pfam:BTB 13 63 4.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143436
AA Change: C25S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115513
Gene: ENSMUSG00000029127
AA Change: C25S

DomainStartEndE-ValueType
Pfam:BTB 15 75 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155300
SMART Domains Protein: ENSMUSP00000122486
Gene: ENSMUSG00000067367

DomainStartEndE-ValueType
Pfam:zf-LYAR 31 58 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202506
Predicted Effect probably benign
Transcript: ENSMUST00000152066
Predicted Effect probably benign
Transcript: ENSMUST00000154975
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,225,319 noncoding transcript Het
4930486L24Rik A G 13: 60,853,596 F106L possibly damaging Het
Adam11 A T 11: 102,773,640 M385L probably benign Het
Adgre1 C T 17: 57,481,007 P925S probably benign Het
Adh7 G A 3: 138,226,326 A234T probably benign Het
Ano2 A G 6: 125,872,740 E475G probably damaging Het
BC055324 A T 1: 163,957,551 V753D probably benign Het
C2cd4c A G 10: 79,612,551 V254A probably benign Het
Car13 A G 3: 14,650,689 Y89C probably damaging Het
Cd38 A G 5: 43,900,386 K100R probably damaging Het
Cdh11 A G 8: 102,634,543 I721T probably damaging Het
Cdh2 G A 18: 16,646,522 Q161* probably null Het
Clk1 T C 1: 58,420,195 K135R probably damaging Het
Col5a1 G A 2: 27,997,599 G961R unknown Het
Cpt1b T A 15: 89,424,273 I151F probably benign Het
Cyp51 A G 5: 4,101,213 F139L probably damaging Het
Disp1 TTGA T 1: 183,088,555 probably null Het
Dnah8 T C 17: 30,810,324 I4089T probably benign Het
Dnali1 C T 4: 125,059,050 V227M possibly damaging Het
Eml4 T G 17: 83,410,085 S29A probably benign Het
Eps8l3 C A 3: 107,879,579 P24T probably benign Het
Fancc A T 13: 63,330,632 probably null Het
Grid2 G A 6: 63,908,991 A124T probably damaging Het
Ikbke C T 1: 131,276,467 probably null Het
Kyat1 G A 2: 30,186,650 A284V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmbrd2 G T 15: 9,175,182 L393F probably benign Het
Lrrc26 T A 2: 25,290,524 L179Q probably damaging Het
Mlx A G 11: 101,088,694 D113G possibly damaging Het
Myod1 A G 7: 46,376,983 K104R probably damaging Het
Nwd1 G A 8: 72,702,974 probably null Het
Olfr1474 A G 19: 13,470,972 M1V probably null Het
Olfr663 T G 7: 104,703,993 V142G probably damaging Het
Olfr788 A C 10: 129,472,877 N62H probably damaging Het
Pacsin3 A T 2: 91,262,781 Y206F probably damaging Het
Pcdhgb5 T A 18: 37,731,917 V255E probably damaging Het
Pdp1 T C 4: 11,960,907 D468G possibly damaging Het
Pgr C T 9: 8,900,599 probably benign Het
Prrt2 T A 7: 127,018,727 Y345F probably benign Het
Rbbp8nl T C 2: 180,278,668 T515A probably damaging Het
Rc3h1 G T 1: 160,930,253 R47L probably damaging Het
Rfpl4b T A 10: 38,821,285 I107F possibly damaging Het
Rsbn1 T C 3: 103,962,485 F754S probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn3a T C 2: 65,507,264 T630A possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slco1a5 C A 6: 142,248,816 C367F probably damaging Het
Slit1 A G 19: 41,625,520 probably null Het
Slit2 G A 5: 48,220,991 probably null Het
Snrnp40 G T 4: 130,365,165 G122V possibly damaging Het
Stk16 T A 1: 75,213,604 M111K probably damaging Het
Tbc1d2 T C 4: 46,616,298 I477V probably benign Het
Tll1 T A 8: 64,117,940 E199D probably damaging Het
Trhde A T 10: 114,588,502 D459E probably benign Het
Ttn T C 2: 76,711,537 R25375G possibly damaging Het
Tubgcp2 A T 7: 139,998,788 M757K possibly damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ubqln5 A G 7: 104,129,425 V64A possibly damaging Het
Usp47 A G 7: 112,109,997 M1337V probably benign Het
Vmn1r201 T A 13: 22,475,239 Y208N probably damaging Het
Xkr8 C T 4: 132,728,057 R335H probably damaging Het
Zeb2 T A 2: 44,997,788 N404I probably damaging Het
Other mutations in Zbtb49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Zbtb49 APN 5 38210616 critical splice donor site probably null
IGL01736:Zbtb49 APN 5 38200860 missense probably damaging 1.00
PIT4585001:Zbtb49 UTSW 5 38216476 missense probably damaging 1.00
R0443:Zbtb49 UTSW 5 38200830 missense probably benign 0.08
R0526:Zbtb49 UTSW 5 38213919 missense probably benign 0.08
R0646:Zbtb49 UTSW 5 38200674 missense probably damaging 1.00
R1200:Zbtb49 UTSW 5 38213331 missense probably damaging 1.00
R1678:Zbtb49 UTSW 5 38213694 missense probably damaging 0.97
R1964:Zbtb49 UTSW 5 38203761 nonsense probably null
R2155:Zbtb49 UTSW 5 38214120 missense possibly damaging 0.86
R2483:Zbtb49 UTSW 5 38203357 intron probably benign
R3617:Zbtb49 UTSW 5 38200631 unclassified probably benign
R4937:Zbtb49 UTSW 5 38213963 missense possibly damaging 0.76
R5579:Zbtb49 UTSW 5 38200816 missense probably damaging 0.99
R6354:Zbtb49 UTSW 5 38203559 missense possibly damaging 0.58
R6426:Zbtb49 UTSW 5 38203087 splice site probably null
R6735:Zbtb49 UTSW 5 38201058 missense possibly damaging 0.74
R6805:Zbtb49 UTSW 5 38213241 intron probably benign
R6869:Zbtb49 UTSW 5 38214350 missense probably damaging 1.00
R7020:Zbtb49 UTSW 5 38213367 nonsense probably null
R7899:Zbtb49 UTSW 5 38213930 nonsense probably null
R8041:Zbtb49 UTSW 5 38200854 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TCGAGTTACTCTGAACACAAAGTG -3'
(R):5'- GAGAACCAAGGGCAGTTTGC -3'

Sequencing Primer
(F):5'- GAAAACCCATAAGCTGTCATTTTG -3'
(R):5'- GCAGTTTGCATTTGGGTCCCC -3'
Posted On2016-11-21