Incidental Mutation 'R5699:Prrt2'
ID446571
Institutional Source Beutler Lab
Gene Symbol Prrt2
Ensembl Gene ENSMUSG00000045114
Gene Nameproline-rich transmembrane protein 2
Synonyms
MMRRC Submission 043327-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5699 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127017531-127021211 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127018727 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 345 (Y345F)
Ref Sequence ENSEMBL: ENSMUSP00000124520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032916] [ENSMUST00000159916] [ENSMUST00000161931] [ENSMUST00000162069] [ENSMUST00000165096] [ENSMUST00000200948] [ENSMUST00000202045] [ENSMUST00000205568] [ENSMUST00000206416] [ENSMUST00000206254] [ENSMUST00000205461] [ENSMUST00000202624] [ENSMUST00000202798]
Predicted Effect probably benign
Transcript: ENSMUST00000032916
SMART Domains Protein: ENSMUSP00000032916
Gene: ENSMUSG00000030678

DomainStartEndE-ValueType
low complexity region 59 82 N/A INTRINSIC
low complexity region 90 126 N/A INTRINSIC
low complexity region 130 179 N/A INTRINSIC
ZnF_C2H2 190 212 4.11e-2 SMART
low complexity region 231 272 N/A INTRINSIC
ZnF_C2H2 279 301 6.78e-3 SMART
ZnF_C2H2 307 329 4.87e-4 SMART
ZnF_C2H2 337 360 1.22e-4 SMART
ZnF_C2H2 366 388 1.79e-2 SMART
ZnF_C2H2 392 413 6.57e0 SMART
low complexity region 435 451 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032918
SMART Domains Protein: ENSMUSP00000032918
Gene: ENSMUSG00000030680

DomainStartEndE-ValueType
low complexity region 64 77 N/A INTRINSIC
Pfam:PAXIP1_C 85 217 7.2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159916
AA Change: Y345F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000124520
Gene: ENSMUSG00000045114
AA Change: Y345F

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
low complexity region 91 112 N/A INTRINSIC
low complexity region 146 169 N/A INTRINSIC
Pfam:CD225 263 337 3.8e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161728
Predicted Effect probably benign
Transcript: ENSMUST00000161931
SMART Domains Protein: ENSMUSP00000143833
Gene: ENSMUSG00000045114

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162069
SMART Domains Protein: ENSMUSP00000123889
Gene: ENSMUSG00000030680

DomainStartEndE-ValueType
Pfam:PAXIP1_C 1 55 2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165096
SMART Domains Protein: ENSMUSP00000127250
Gene: ENSMUSG00000030681

DomainStartEndE-ValueType
Pfam:Vault 122 163 5.4e-18 PFAM
Pfam:Vault 175 215 7.7e-16 PFAM
Pfam:Vault 228 271 7.9e-14 PFAM
Pfam:Vault 333 377 2.8e-16 PFAM
Pfam:MVP_shoulder 528 656 5.9e-55 PFAM
low complexity region 707 720 N/A INTRINSIC
low complexity region 733 749 N/A INTRINSIC
low complexity region 751 761 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172958
SMART Domains Protein: ENSMUSP00000134420
Gene: ENSMUSG00000092534

DomainStartEndE-ValueType
Pfam:PAXIP1_C 1 72 1.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200948
SMART Domains Protein: ENSMUSP00000144469
Gene: ENSMUSG00000030680

DomainStartEndE-ValueType
low complexity region 64 77 N/A INTRINSIC
Pfam:PAXIP1_C 85 217 7.2e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201606
Predicted Effect probably benign
Transcript: ENSMUST00000201686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201963
Predicted Effect probably benign
Transcript: ENSMUST00000202045
AA Change: Y60F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144042
Gene: ENSMUSG00000045114
AA Change: Y60F

DomainStartEndE-ValueType
Pfam:CD225 1 52 3.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206511
Predicted Effect probably benign
Transcript: ENSMUST00000205568
Predicted Effect probably benign
Transcript: ENSMUST00000206416
Predicted Effect probably benign
Transcript: ENSMUST00000206254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202936
Predicted Effect probably benign
Transcript: ENSMUST00000205461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206953
Predicted Effect probably benign
Transcript: ENSMUST00000202624
SMART Domains Protein: ENSMUSP00000144099
Gene: ENSMUSG00000107068

DomainStartEndE-ValueType
low complexity region 64 77 N/A INTRINSIC
Pfam:PAXIP1_C 85 176 5.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202798
SMART Domains Protein: ENSMUSP00000144243
Gene: ENSMUSG00000107068

DomainStartEndE-ValueType
low complexity region 64 77 N/A INTRINSIC
Pfam:PAXIP1_C 85 217 7.2e-54 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing a proline-rich domain in its N-terminal half. Studies in mice suggest that it is predominantly expressed in brain and spinal cord in embryonic and postnatal stages. Mutations in this gene are associated with episodic kinesigenic dyskinesia-1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele develop paroxysmal movements (bouncing and back walking) at the onset of locomotion and exhibit wild running and jumping in response to audiogenic stimuli and an increased sensitivity to the convulsive effects of pentylentetrazol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,225,319 noncoding transcript Het
4930486L24Rik A G 13: 60,853,596 F106L possibly damaging Het
Adam11 A T 11: 102,773,640 M385L probably benign Het
Adgre1 C T 17: 57,481,007 P925S probably benign Het
Adh7 G A 3: 138,226,326 A234T probably benign Het
Ano2 A G 6: 125,872,740 E475G probably damaging Het
BC055324 A T 1: 163,957,551 V753D probably benign Het
C2cd4c A G 10: 79,612,551 V254A probably benign Het
Car13 A G 3: 14,650,689 Y89C probably damaging Het
Cd38 A G 5: 43,900,386 K100R probably damaging Het
Cdh11 A G 8: 102,634,543 I721T probably damaging Het
Cdh2 G A 18: 16,646,522 Q161* probably null Het
Clk1 T C 1: 58,420,195 K135R probably damaging Het
Col5a1 G A 2: 27,997,599 G961R unknown Het
Cpt1b T A 15: 89,424,273 I151F probably benign Het
Cyp51 A G 5: 4,101,213 F139L probably damaging Het
Disp1 TTGA T 1: 183,088,555 probably null Het
Dnah8 T C 17: 30,810,324 I4089T probably benign Het
Dnali1 C T 4: 125,059,050 V227M possibly damaging Het
Eml4 T G 17: 83,410,085 S29A probably benign Het
Eps8l3 C A 3: 107,879,579 P24T probably benign Het
Fancc A T 13: 63,330,632 probably null Het
Grid2 G A 6: 63,908,991 A124T probably damaging Het
Ikbke C T 1: 131,276,467 probably null Het
Kyat1 G A 2: 30,186,650 A284V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmbrd2 G T 15: 9,175,182 L393F probably benign Het
Lrrc26 T A 2: 25,290,524 L179Q probably damaging Het
Mlx A G 11: 101,088,694 D113G possibly damaging Het
Myod1 A G 7: 46,376,983 K104R probably damaging Het
Nwd1 G A 8: 72,702,974 probably null Het
Olfr1474 A G 19: 13,470,972 M1V probably null Het
Olfr663 T G 7: 104,703,993 V142G probably damaging Het
Olfr788 A C 10: 129,472,877 N62H probably damaging Het
Pacsin3 A T 2: 91,262,781 Y206F probably damaging Het
Pcdhgb5 T A 18: 37,731,917 V255E probably damaging Het
Pdp1 T C 4: 11,960,907 D468G possibly damaging Het
Pgr C T 9: 8,900,599 probably benign Het
Rbbp8nl T C 2: 180,278,668 T515A probably damaging Het
Rc3h1 G T 1: 160,930,253 R47L probably damaging Het
Rfpl4b T A 10: 38,821,285 I107F possibly damaging Het
Rsbn1 T C 3: 103,962,485 F754S probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn3a T C 2: 65,507,264 T630A possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slco1a5 C A 6: 142,248,816 C367F probably damaging Het
Slit1 A G 19: 41,625,520 probably null Het
Slit2 G A 5: 48,220,991 probably null Het
Snrnp40 G T 4: 130,365,165 G122V possibly damaging Het
Stk16 T A 1: 75,213,604 M111K probably damaging Het
Tbc1d2 T C 4: 46,616,298 I477V probably benign Het
Tll1 T A 8: 64,117,940 E199D probably damaging Het
Trhde A T 10: 114,588,502 D459E probably benign Het
Ttn T C 2: 76,711,537 R25375G possibly damaging Het
Tubgcp2 A T 7: 139,998,788 M757K possibly damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ubqln5 A G 7: 104,129,425 V64A possibly damaging Het
Usp47 A G 7: 112,109,997 M1337V probably benign Het
Vmn1r201 T A 13: 22,475,239 Y208N probably damaging Het
Xkr8 C T 4: 132,728,057 R335H probably damaging Het
Zbtb49 A T 5: 38,216,526 C25S probably damaging Het
Zeb2 T A 2: 44,997,788 N404I probably damaging Het
Other mutations in Prrt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1987:Prrt2 UTSW 7 127018730 missense probably benign 0.00
R2012:Prrt2 UTSW 7 127019409 missense probably damaging 1.00
R2504:Prrt2 UTSW 7 127020224 missense possibly damaging 0.84
R5622:Prrt2 UTSW 7 127019765 missense probably benign 0.02
R5655:Prrt2 UTSW 7 127019402 missense probably damaging 1.00
R5704:Prrt2 UTSW 7 127019418 missense probably damaging 1.00
R6765:Prrt2 UTSW 7 127019597 missense probably damaging 1.00
R7910:Prrt2 UTSW 7 127020047 missense possibly damaging 0.57
Z1177:Prrt2 UTSW 7 127018884 missense probably null 0.67
Predicted Primers PCR Primer
(F):5'- CAGAGAGGTTTTCAGAGTGCAG -3'
(R):5'- TCAACTTAGGCGGTGAGTGG -3'

Sequencing Primer
(F):5'- CTATGGCTGGCAGAGGAGC -3'
(R):5'- TGAGTGGGGGTCAGGGAC -3'
Posted On2016-11-21