Incidental Mutation 'R5699:Olfr788'
ID446582
Institutional Source Beutler Lab
Gene Symbol Olfr788
Ensembl Gene ENSMUSG00000049217
Gene Nameolfactory receptor 788
SynonymsMOR111-4, GA_x6K02T2PULF-11151514-11152449
MMRRC Submission 043327-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R5699 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129470998-129476618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 129472877 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 62 (N62H)
Ref Sequence ENSEMBL: ENSMUSP00000151054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056961] [ENSMUST00000213222]
Predicted Effect probably damaging
Transcript: ENSMUST00000056961
AA Change: N62H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054710
Gene: ENSMUSG00000049217
AA Change: N62H

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.8e-49 PFAM
Pfam:7tm_1 38 287 1.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213222
AA Change: N62H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,225,319 noncoding transcript Het
4930486L24Rik A G 13: 60,853,596 F106L possibly damaging Het
Adam11 A T 11: 102,773,640 M385L probably benign Het
Adgre1 C T 17: 57,481,007 P925S probably benign Het
Adh7 G A 3: 138,226,326 A234T probably benign Het
Ano2 A G 6: 125,872,740 E475G probably damaging Het
BC055324 A T 1: 163,957,551 V753D probably benign Het
C2cd4c A G 10: 79,612,551 V254A probably benign Het
Car13 A G 3: 14,650,689 Y89C probably damaging Het
Cd38 A G 5: 43,900,386 K100R probably damaging Het
Cdh11 A G 8: 102,634,543 I721T probably damaging Het
Cdh2 G A 18: 16,646,522 Q161* probably null Het
Clk1 T C 1: 58,420,195 K135R probably damaging Het
Col5a1 G A 2: 27,997,599 G961R unknown Het
Cpt1b T A 15: 89,424,273 I151F probably benign Het
Cyp51 A G 5: 4,101,213 F139L probably damaging Het
Disp1 TTGA T 1: 183,088,555 probably null Het
Dnah8 T C 17: 30,810,324 I4089T probably benign Het
Dnali1 C T 4: 125,059,050 V227M possibly damaging Het
Eml4 T G 17: 83,410,085 S29A probably benign Het
Eps8l3 C A 3: 107,879,579 P24T probably benign Het
Fancc A T 13: 63,330,632 probably null Het
Grid2 G A 6: 63,908,991 A124T probably damaging Het
Ikbke C T 1: 131,276,467 probably null Het
Kyat1 G A 2: 30,186,650 A284V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmbrd2 G T 15: 9,175,182 L393F probably benign Het
Lrrc26 T A 2: 25,290,524 L179Q probably damaging Het
Mlx A G 11: 101,088,694 D113G possibly damaging Het
Myod1 A G 7: 46,376,983 K104R probably damaging Het
Nwd1 G A 8: 72,702,974 probably null Het
Olfr1474 A G 19: 13,470,972 M1V probably null Het
Olfr663 T G 7: 104,703,993 V142G probably damaging Het
Pacsin3 A T 2: 91,262,781 Y206F probably damaging Het
Pcdhgb5 T A 18: 37,731,917 V255E probably damaging Het
Pdp1 T C 4: 11,960,907 D468G possibly damaging Het
Pgr C T 9: 8,900,599 probably benign Het
Prrt2 T A 7: 127,018,727 Y345F probably benign Het
Rbbp8nl T C 2: 180,278,668 T515A probably damaging Het
Rc3h1 G T 1: 160,930,253 R47L probably damaging Het
Rfpl4b T A 10: 38,821,285 I107F possibly damaging Het
Rsbn1 T C 3: 103,962,485 F754S probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn3a T C 2: 65,507,264 T630A possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slco1a5 C A 6: 142,248,816 C367F probably damaging Het
Slit1 A G 19: 41,625,520 probably null Het
Slit2 G A 5: 48,220,991 probably null Het
Snrnp40 G T 4: 130,365,165 G122V possibly damaging Het
Stk16 T A 1: 75,213,604 M111K probably damaging Het
Tbc1d2 T C 4: 46,616,298 I477V probably benign Het
Tll1 T A 8: 64,117,940 E199D probably damaging Het
Trhde A T 10: 114,588,502 D459E probably benign Het
Ttn T C 2: 76,711,537 R25375G possibly damaging Het
Tubgcp2 A T 7: 139,998,788 M757K possibly damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ubqln5 A G 7: 104,129,425 V64A possibly damaging Het
Usp47 A G 7: 112,109,997 M1337V probably benign Het
Vmn1r201 T A 13: 22,475,239 Y208N probably damaging Het
Xkr8 C T 4: 132,728,057 R335H probably damaging Het
Zbtb49 A T 5: 38,216,526 C25S probably damaging Het
Zeb2 T A 2: 44,997,788 N404I probably damaging Het
Other mutations in Olfr788
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Olfr788 APN 10 129473211 missense probably damaging 1.00
IGL02393:Olfr788 APN 10 129473195 missense probably damaging 1.00
IGL03010:Olfr788 APN 10 129472974 missense probably damaging 1.00
IGL03325:Olfr788 APN 10 129473605 missense probably benign 0.02
R1298:Olfr788 UTSW 10 129473064 missense probably damaging 1.00
R2215:Olfr788 UTSW 10 129473420 missense probably damaging 0.99
R5482:Olfr788 UTSW 10 129473078 missense probably benign 0.31
R5794:Olfr788 UTSW 10 129473426 missense possibly damaging 0.95
R6436:Olfr788 UTSW 10 129472904 missense probably damaging 0.98
R6480:Olfr788 UTSW 10 129472721 missense possibly damaging 0.62
R6884:Olfr788 UTSW 10 129473154 missense probably damaging 1.00
R7908:Olfr788 UTSW 10 129472998 missense probably damaging 1.00
R7989:Olfr788 UTSW 10 129472998 missense probably damaging 1.00
R8056:Olfr788 UTSW 10 129473192 missense probably benign 0.07
R8207:Olfr788 UTSW 10 129473084 missense probably benign 0.09
Z1176:Olfr788 UTSW 10 129473615 missense probably benign 0.04
Z1177:Olfr788 UTSW 10 129473064 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAAGAGGCCACTAAATAAGCTG -3'
(R):5'- GGCAACATAGCGGTCATAGGA -3'

Sequencing Primer
(F):5'- GAGGCCACTAAATAAGCTGCACTC -3'
(R):5'- CATAGCGGTCATAGGACATGGC -3'
Posted On2016-11-21