Incidental Mutation 'R5699:Cpt1b'
ID446589
Institutional Source Beutler Lab
Gene Symbol Cpt1b
Ensembl Gene ENSMUSG00000078937
Gene Namecarnitine palmitoyltransferase 1b, muscle
SynonymsM-CPTI, M-CPT I, Cpt1
MMRRC Submission 043327-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5699 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89416405-89425863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89424273 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 151 (I151F)
Ref Sequence ENSEMBL: ENSMUSP00000104936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023289] [ENSMUST00000052315] [ENSMUST00000109313] [ENSMUST00000168376] [ENSMUST00000170460] [ENSMUST00000171666]
Predicted Effect probably benign
Transcript: ENSMUST00000023289
SMART Domains Protein: ENSMUSP00000023289
Gene: ENSMUSG00000022617

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:APH 70 317 1.9e-14 PFAM
Pfam:Choline_kinase 97 308 1.5e-76 PFAM
low complexity region 324 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052315
Predicted Effect probably benign
Transcript: ENSMUST00000109313
AA Change: I151F

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104936
Gene: ENSMUSG00000078937
AA Change: I151F

DomainStartEndE-ValueType
Pfam:CPT_N 1 47 2.5e-29 PFAM
Pfam:Carn_acyltransf 173 762 1.3e-183 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166267
Predicted Effect probably benign
Transcript: ENSMUST00000168376
SMART Domains Protein: ENSMUSP00000129786
Gene: ENSMUSG00000078937

DomainStartEndE-ValueType
PDB:2LE3|A 1 42 1e-21 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000168879
SMART Domains Protein: ENSMUSP00000128188
Gene: ENSMUSG00000078937

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 3 148 3.5e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171140
Predicted Effect probably benign
Transcript: ENSMUST00000170460
SMART Domains Protein: ENSMUSP00000128026
Gene: ENSMUSG00000022617

DomainStartEndE-ValueType
Pfam:Choline_kinase 1 176 1e-65 PFAM
Pfam:APH 8 176 6.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171666
SMART Domains Protein: ENSMUSP00000127191
Gene: ENSMUSG00000022617

DomainStartEndE-ValueType
Pfam:Choline_kinase 1 142 2.5e-51 PFAM
Pfam:APH 1 149 6.9e-14 PFAM
Pfam:EcKinase 2 116 8.8e-8 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, a member of the carnitine/choline acetyltransferase family, is the rate-controlling enzyme of the long-chain fatty acid beta-oxidation pathway in muscle mitochondria. This enzyme is required for the net transport of long-chain fatty acyl-CoAs from the cytoplasm into the mitochondria. Multiple transcript variants encoding different isoforms have been found for this gene, and read-through transcripts are expressed from the upstream locus that include exons from this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygous null mice die in utero prior to E9.5. Heterozygous mutant mice exhibit susceptibility to fatal hypothermia following cold exposure, with females more severely affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,225,319 noncoding transcript Het
4930486L24Rik A G 13: 60,853,596 F106L possibly damaging Het
Adam11 A T 11: 102,773,640 M385L probably benign Het
Adgre1 C T 17: 57,481,007 P925S probably benign Het
Adh7 G A 3: 138,226,326 A234T probably benign Het
Ano2 A G 6: 125,872,740 E475G probably damaging Het
BC055324 A T 1: 163,957,551 V753D probably benign Het
C2cd4c A G 10: 79,612,551 V254A probably benign Het
Car13 A G 3: 14,650,689 Y89C probably damaging Het
Cd38 A G 5: 43,900,386 K100R probably damaging Het
Cdh11 A G 8: 102,634,543 I721T probably damaging Het
Cdh2 G A 18: 16,646,522 Q161* probably null Het
Clk1 T C 1: 58,420,195 K135R probably damaging Het
Col5a1 G A 2: 27,997,599 G961R unknown Het
Cyp51 A G 5: 4,101,213 F139L probably damaging Het
Disp1 TTGA T 1: 183,088,555 probably null Het
Dnah8 T C 17: 30,810,324 I4089T probably benign Het
Dnali1 C T 4: 125,059,050 V227M possibly damaging Het
Eml4 T G 17: 83,410,085 S29A probably benign Het
Eps8l3 C A 3: 107,879,579 P24T probably benign Het
Fancc A T 13: 63,330,632 probably null Het
Grid2 G A 6: 63,908,991 A124T probably damaging Het
Ikbke C T 1: 131,276,467 probably null Het
Kyat1 G A 2: 30,186,650 A284V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmbrd2 G T 15: 9,175,182 L393F probably benign Het
Lrrc26 T A 2: 25,290,524 L179Q probably damaging Het
Mlx A G 11: 101,088,694 D113G possibly damaging Het
Myod1 A G 7: 46,376,983 K104R probably damaging Het
Nwd1 G A 8: 72,702,974 probably null Het
Olfr1474 A G 19: 13,470,972 M1V probably null Het
Olfr663 T G 7: 104,703,993 V142G probably damaging Het
Olfr788 A C 10: 129,472,877 N62H probably damaging Het
Pacsin3 A T 2: 91,262,781 Y206F probably damaging Het
Pcdhgb5 T A 18: 37,731,917 V255E probably damaging Het
Pdp1 T C 4: 11,960,907 D468G possibly damaging Het
Pgr C T 9: 8,900,599 probably benign Het
Prrt2 T A 7: 127,018,727 Y345F probably benign Het
Rbbp8nl T C 2: 180,278,668 T515A probably damaging Het
Rc3h1 G T 1: 160,930,253 R47L probably damaging Het
Rfpl4b T A 10: 38,821,285 I107F possibly damaging Het
Rsbn1 T C 3: 103,962,485 F754S probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn3a T C 2: 65,507,264 T630A possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slco1a5 C A 6: 142,248,816 C367F probably damaging Het
Slit1 A G 19: 41,625,520 probably null Het
Slit2 G A 5: 48,220,991 probably null Het
Snrnp40 G T 4: 130,365,165 G122V possibly damaging Het
Stk16 T A 1: 75,213,604 M111K probably damaging Het
Tbc1d2 T C 4: 46,616,298 I477V probably benign Het
Tll1 T A 8: 64,117,940 E199D probably damaging Het
Trhde A T 10: 114,588,502 D459E probably benign Het
Ttn T C 2: 76,711,537 R25375G possibly damaging Het
Tubgcp2 A T 7: 139,998,788 M757K possibly damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ubqln5 A G 7: 104,129,425 V64A possibly damaging Het
Usp47 A G 7: 112,109,997 M1337V probably benign Het
Vmn1r201 T A 13: 22,475,239 Y208N probably damaging Het
Xkr8 C T 4: 132,728,057 R335H probably damaging Het
Zbtb49 A T 5: 38,216,526 C25S probably damaging Het
Zeb2 T A 2: 44,997,788 N404I probably damaging Het
Other mutations in Cpt1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Cpt1b APN 15 89420863 missense probably benign 0.01
IGL00497:Cpt1b APN 15 89422293 missense probably benign 0.22
IGL01142:Cpt1b APN 15 89418993 missense probably benign
IGL02329:Cpt1b APN 15 89423739 missense probably benign
IGL02740:Cpt1b APN 15 89424332 missense probably damaging 1.00
IGL03196:Cpt1b APN 15 89424395 missense probably benign
macellaio UTSW 15 89423654 critical splice donor site probably null
oleagenous UTSW 15 89425214 missense probably damaging 1.00
IGL02796:Cpt1b UTSW 15 89424802 missense probably benign 0.04
PIT4519001:Cpt1b UTSW 15 89418863 missense probably damaging 1.00
R0276:Cpt1b UTSW 15 89419959 missense probably benign 0.12
R0302:Cpt1b UTSW 15 89417870 missense probably benign
R0454:Cpt1b UTSW 15 89424393 missense possibly damaging 0.47
R1199:Cpt1b UTSW 15 89419010 missense probably benign 0.01
R1633:Cpt1b UTSW 15 89418815 missense probably damaging 0.98
R1674:Cpt1b UTSW 15 89422332 missense possibly damaging 0.64
R2087:Cpt1b UTSW 15 89422208 missense probably benign 0.07
R2178:Cpt1b UTSW 15 89419043 missense probably damaging 1.00
R2414:Cpt1b UTSW 15 89420080 splice site probably benign
R2507:Cpt1b UTSW 15 89419098 missense probably benign 0.08
R2883:Cpt1b UTSW 15 89417869 missense probably benign 0.00
R3432:Cpt1b UTSW 15 89423741 missense possibly damaging 0.85
R3783:Cpt1b UTSW 15 89425189 missense probably damaging 1.00
R4574:Cpt1b UTSW 15 89424044 splice site probably null
R4737:Cpt1b UTSW 15 89421406 missense probably benign 0.03
R5122:Cpt1b UTSW 15 89424023 missense probably benign 0.09
R5320:Cpt1b UTSW 15 89419274 missense probably benign 0.00
R5365:Cpt1b UTSW 15 89420107 missense possibly damaging 0.78
R5710:Cpt1b UTSW 15 89425206 missense probably damaging 1.00
R5873:Cpt1b UTSW 15 89420728 missense probably damaging 1.00
R5941:Cpt1b UTSW 15 89425214 missense probably damaging 1.00
R6163:Cpt1b UTSW 15 89424417 missense probably benign 0.15
R6197:Cpt1b UTSW 15 89424834 missense possibly damaging 0.77
R6323:Cpt1b UTSW 15 89419063 missense probably benign 0.10
R6486:Cpt1b UTSW 15 89420824 missense probably benign
R7571:Cpt1b UTSW 15 89421343 critical splice donor site probably null
R7648:Cpt1b UTSW 15 89421367 missense probably damaging 1.00
R7743:Cpt1b UTSW 15 89421404 missense probably benign 0.25
R7893:Cpt1b UTSW 15 89423654 critical splice donor site probably null
R8021:Cpt1b UTSW 15 89421426 missense probably benign 0.00
R8207:Cpt1b UTSW 15 89418815 missense probably damaging 0.98
R8394:Cpt1b UTSW 15 89422287 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CGGACACAGATCTGAAGGTAC -3'
(R):5'- ATAGGTATGGCCACTTTGGGAC -3'

Sequencing Primer
(F):5'- AGCAGAGCGTTGGGGTC -3'
(R):5'- TGGGACCCCACAGACAGAG -3'
Posted On2016-11-21