Incidental Mutation 'R5699:Adgre1'
ID446592
Institutional Source Beutler Lab
Gene Symbol Adgre1
Ensembl Gene ENSMUSG00000004730
Gene Nameadhesion G protein-coupled receptor E1
SynonymsEmr1, EGF-TM7, F4/80, DD7A5-7, TM7LN3, Ly71
MMRRC Submission 043327-MU
Accession Numbers

Ncbi RefSeq: NM_010130.4 ;MGI:106912

Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R5699 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location57358686-57483529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 57481007 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 925 (P925S)
Ref Sequence ENSEMBL: ENSMUSP00000083971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004850] [ENSMUST00000086763]
Predicted Effect probably benign
Transcript: ENSMUST00000004850
AA Change: P925S

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000004850
Gene: ENSMUSG00000004730
AA Change: P925S

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086763
AA Change: P925S

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000083971
Gene: ENSMUSG00000004730
AA Change: P925S

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype Strain: 3582333
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,225,319 noncoding transcript Het
4930486L24Rik A G 13: 60,853,596 F106L possibly damaging Het
Adam11 A T 11: 102,773,640 M385L probably benign Het
Adh7 G A 3: 138,226,326 A234T probably benign Het
Ano2 A G 6: 125,872,740 E475G probably damaging Het
BC055324 A T 1: 163,957,551 V753D probably benign Het
C2cd4c A G 10: 79,612,551 V254A probably benign Het
Car13 A G 3: 14,650,689 Y89C probably damaging Het
Cd38 A G 5: 43,900,386 K100R probably damaging Het
Cdh11 A G 8: 102,634,543 I721T probably damaging Het
Cdh2 G A 18: 16,646,522 Q161* probably null Het
Clk1 T C 1: 58,420,195 K135R probably damaging Het
Col5a1 G A 2: 27,997,599 G961R unknown Het
Cpt1b T A 15: 89,424,273 I151F probably benign Het
Cyp51 A G 5: 4,101,213 F139L probably damaging Het
Disp1 TTGA T 1: 183,088,555 probably null Het
Dnah8 T C 17: 30,810,324 I4089T probably benign Het
Dnali1 C T 4: 125,059,050 V227M possibly damaging Het
Eml4 T G 17: 83,410,085 S29A probably benign Het
Eps8l3 C A 3: 107,879,579 P24T probably benign Het
Fancc A T 13: 63,330,632 probably null Het
Grid2 G A 6: 63,908,991 A124T probably damaging Het
Ikbke C T 1: 131,276,467 probably null Het
Kyat1 G A 2: 30,186,650 A284V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmbrd2 G T 15: 9,175,182 L393F probably benign Het
Lrrc26 T A 2: 25,290,524 L179Q probably damaging Het
Mlx A G 11: 101,088,694 D113G possibly damaging Het
Myod1 A G 7: 46,376,983 K104R probably damaging Het
Nwd1 G A 8: 72,702,974 probably null Het
Olfr1474 A G 19: 13,470,972 M1V probably null Het
Olfr663 T G 7: 104,703,993 V142G probably damaging Het
Olfr788 A C 10: 129,472,877 N62H probably damaging Het
Pacsin3 A T 2: 91,262,781 Y206F probably damaging Het
Pcdhgb5 T A 18: 37,731,917 V255E probably damaging Het
Pdp1 T C 4: 11,960,907 D468G possibly damaging Het
Pgr C T 9: 8,900,599 probably benign Het
Prrt2 T A 7: 127,018,727 Y345F probably benign Het
Rbbp8nl T C 2: 180,278,668 T515A probably damaging Het
Rc3h1 G T 1: 160,930,253 R47L probably damaging Het
Rfpl4b T A 10: 38,821,285 I107F possibly damaging Het
Rsbn1 T C 3: 103,962,485 F754S probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn3a T C 2: 65,507,264 T630A possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slco1a5 C A 6: 142,248,816 C367F probably damaging Het
Slit1 A G 19: 41,625,520 probably null Het
Slit2 G A 5: 48,220,991 probably null Het
Snrnp40 G T 4: 130,365,165 G122V possibly damaging Het
Stk16 T A 1: 75,213,604 M111K probably damaging Het
Tbc1d2 T C 4: 46,616,298 I477V probably benign Het
Tll1 T A 8: 64,117,940 E199D probably damaging Het
Trhde A T 10: 114,588,502 D459E probably benign Het
Ttn T C 2: 76,711,537 R25375G possibly damaging Het
Tubgcp2 A T 7: 139,998,788 M757K possibly damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ubqln5 A G 7: 104,129,425 V64A possibly damaging Het
Usp47 A G 7: 112,109,997 M1337V probably benign Het
Vmn1r201 T A 13: 22,475,239 Y208N probably damaging Het
Xkr8 C T 4: 132,728,057 R335H probably damaging Het
Zbtb49 A T 5: 38,216,526 C25S probably damaging Het
Zeb2 T A 2: 44,997,788 N404I probably damaging Het
Other mutations in Adgre1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgre1 APN 17 57450055 missense probably benign 0.00
IGL00966:Adgre1 APN 17 57419335 missense probably benign 0.04
IGL01680:Adgre1 APN 17 57402620 missense unknown
IGL01724:Adgre1 APN 17 57444064 nonsense probably null
IGL02172:Adgre1 APN 17 57478879 missense probably damaging 1.00
IGL02260:Adgre1 APN 17 57447891 missense probably benign 0.01
IGL02272:Adgre1 APN 17 57450021 nonsense probably null
IGL02336:Adgre1 APN 17 57411024 nonsense probably null
IGL02346:Adgre1 APN 17 57443919 missense probably benign 0.15
IGL02398:Adgre1 APN 17 57402824 nonsense probably null
IGL02618:Adgre1 APN 17 57444021 missense possibly damaging 0.66
IGL02690:Adgre1 APN 17 57480921 missense probably damaging 1.00
IGL02936:Adgre1 APN 17 57478833 missense probably benign 0.26
IGL03112:Adgre1 APN 17 57448029 splice site probably null
IGL03350:Adgre1 APN 17 57401908 missense probably benign 0.16
F480 UTSW 17 57444063 missense probably damaging 1.00
lomax UTSW 17 57402811 missense unknown
Onion UTSW 17 57402841 nonsense probably null
Scallion UTSW 17 57401977 missense possibly damaging 0.90
R0049:Adgre1 UTSW 17 57402841 nonsense probably null
R0153:Adgre1 UTSW 17 57443939 missense possibly damaging 0.92
R0277:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0278:Adgre1 UTSW 17 57447872 missense probably benign 0.07
R0323:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0389:Adgre1 UTSW 17 57406839 missense possibly damaging 0.80
R0492:Adgre1 UTSW 17 57402742 missense unknown
R0621:Adgre1 UTSW 17 57441359 missense probably damaging 0.98
R0647:Adgre1 UTSW 17 57411003 missense probably damaging 1.00
R1310:Adgre1 UTSW 17 57447936 missense probably benign 0.00
R1601:Adgre1 UTSW 17 57441353 missense probably benign 0.01
R1689:Adgre1 UTSW 17 57449921 missense probably benign 0.31
R1708:Adgre1 UTSW 17 57401974 missense possibly damaging 0.93
R1796:Adgre1 UTSW 17 57441350 missense probably benign 0.43
R1839:Adgre1 UTSW 17 57441299 missense probably benign 0.00
R1860:Adgre1 UTSW 17 57441363 missense probably benign 0.00
R2165:Adgre1 UTSW 17 57419338 missense probably damaging 0.97
R2219:Adgre1 UTSW 17 57401912 missense possibly damaging 0.92
R2519:Adgre1 UTSW 17 57410956 missense probably damaging 1.00
R3874:Adgre1 UTSW 17 57401925 missense probably benign 0.08
R3911:Adgre1 UTSW 17 57447860 missense probably damaging 1.00
R4190:Adgre1 UTSW 17 57402811 missense unknown
R4439:Adgre1 UTSW 17 57447954 missense probably damaging 1.00
R4513:Adgre1 UTSW 17 57410947 missense probably benign 0.34
R4529:Adgre1 UTSW 17 57420519 missense possibly damaging 0.92
R4543:Adgre1 UTSW 17 57406874 missense probably benign 0.07
R4610:Adgre1 UTSW 17 57450073 missense possibly damaging 0.50
R4665:Adgre1 UTSW 17 57480947 missense probably benign 0.20
R4911:Adgre1 UTSW 17 57447832 missense possibly damaging 0.57
R4928:Adgre1 UTSW 17 57444064 nonsense probably null
R4942:Adgre1 UTSW 17 57406903 missense probably damaging 1.00
R4946:Adgre1 UTSW 17 57443918 missense probably benign 0.33
R4953:Adgre1 UTSW 17 57441321 missense probably damaging 0.99
R5107:Adgre1 UTSW 17 57401977 missense possibly damaging 0.90
R5366:Adgre1 UTSW 17 57402817 missense probably benign 0.39
R5590:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R5619:Adgre1 UTSW 17 57420437 missense probably benign 0.15
R5734:Adgre1 UTSW 17 57443990 missense probably benign 0.00
R5860:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6149:Adgre1 UTSW 17 57445018 missense probably benign 0.08
R6478:Adgre1 UTSW 17 57401955 missense possibly damaging 0.81
R6709:Adgre1 UTSW 17 57406917 missense probably benign 0.10
R6864:Adgre1 UTSW 17 57478879 missense probably damaging 1.00
R6945:Adgre1 UTSW 17 57410844 missense probably benign 0.01
R6945:Adgre1 UTSW 17 57420399 missense probably benign 0.39
R6988:Adgre1 UTSW 17 57408445 missense probably benign 0.00
R7019:Adgre1 UTSW 17 57410945 missense probably damaging 0.98
R7154:Adgre1 UTSW 17 57444087 splice site probably null
R7347:Adgre1 UTSW 17 57420441 missense probably damaging 1.00
R7459:Adgre1 UTSW 17 57449933 missense probably damaging 1.00
R7709:Adgre1 UTSW 17 57402519 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCCATGTTGGTACCCACC -3'
(R):5'- CAAACCCTGAGATCCTGGCC -3'

Sequencing Primer
(F):5'- GGCTTGATCTTGTACAGGTACCAAC -3'
(R):5'- TGAGATCCTGGCCCCAATATC -3'
Posted On2016-11-21