Mutagenetix > Incidental Mutation

Incidental Mutation 'R5699:Olfr1474'

446599

Institutional Source

Beutler Lab

Gene Symbol

Olfr1474

Ensembl Gene

ENSMUSG00000096273

Gene Name

olfactory receptor 1474

Synonyms

MOR202-42, MOR202-26P, GA_x6K02T2RE5P-3803583-3804527

MMRRC Submission

043327-MU

Accession Numbers

Genbank: NM_001011842.1

Essential gene?

Probably non essential (E-score: 0.074) question?

Stock #

R5699 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

13469565-13472157 bp(+) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

A to G at 13470972 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 1 (M1V)

Ref Sequence

ENSEMBL: ENSMUSP00000151810 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096202] [ENSMUST00000207529] [ENSMUST00000220113]

AlphaFold

Q7TQQ8

Predicted Effect

probably null
Transcript: ENSMUST00000096202
AA Change: M1V

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000093916
Gene: ENSMUSG00000096273
AA Change: M1V

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	306	1.6e-52	PFAM
Pfam:7TM_GPCR_Srsx	33	303	1e-7	PFAM
Pfam:7tm_1	39	288	8.7e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000207529

Predicted Effect

probably null
Transcript: ENSMUST00000220113
AA Change: M1V

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

none

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700128F08Rik	A	G	9: 8,225,319		noncoding transcript	Het
4930486L24Rik	A	G	13: 60,853,596	F106L	possibly damaging	Het
Adam11	A	T	11: 102,773,640	M385L	probably benign	Het
Adgre1	C	T	17: 57,481,007	P925S	probably benign	Het
Adh7	G	A	3: 138,226,326	A234T	probably benign	Het
Ano2	A	G	6: 125,872,740	E475G	probably damaging	Het
BC055324	A	T	1: 163,957,551	V753D	probably benign	Het
C2cd4c	A	G	10: 79,612,551	V254A	probably benign	Het
Car13	A	G	3: 14,650,689	Y89C	probably damaging	Het
Cd38	A	G	5: 43,900,386	K100R	probably damaging	Het
Cdh11	A	G	8: 102,634,543	I721T	probably damaging	Het
Cdh2	G	A	18: 16,646,522	Q161*	probably null	Het
Clk1	T	C	1: 58,420,195	K135R	probably damaging	Het
Col5a1	G	A	2: 27,997,599	G961R	unknown	Het
Cpt1b	T	A	15: 89,424,273	I151F	probably benign	Het
Cyp51	A	G	5: 4,101,213	F139L	probably damaging	Het
Disp1	TTGA	T	1: 183,088,555		probably null	Het
Dnah8	T	C	17: 30,810,324	I4089T	probably benign	Het
Dnali1	C	T	4: 125,059,050	V227M	possibly damaging	Het
Eml4	T	G	17: 83,410,085	S29A	probably benign	Het
Eps8l3	C	A	3: 107,879,579	P24T	probably benign	Het
Fancc	A	T	13: 63,330,632		probably null	Het
Grid2	G	A	6: 63,908,991	A124T	probably damaging	Het
Ikbke	C	T	1: 131,276,467		probably null	Het
Kyat1	G	A	2: 30,186,650	A284V	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lmbrd2	G	T	15: 9,175,182	L393F	probably benign	Het
Lrrc26	T	A	2: 25,290,524	L179Q	probably damaging	Het
Mlx	A	G	11: 101,088,694	D113G	possibly damaging	Het
Myod1	A	G	7: 46,376,983	K104R	probably damaging	Het
Nwd1	G	A	8: 72,702,974		probably null	Het
Olfr663	T	G	7: 104,703,993	V142G	probably damaging	Het
Olfr788	A	C	10: 129,472,877	N62H	probably damaging	Het
Pacsin3	A	T	2: 91,262,781	Y206F	probably damaging	Het
Pcdhgb5	T	A	18: 37,731,917	V255E	probably damaging	Het
Pdp1	T	C	4: 11,960,907	D468G	possibly damaging	Het
Pgr	C	T	9: 8,900,599		probably benign	Het
Prrt2	T	A	7: 127,018,727	Y345F	probably benign	Het
Rbbp8nl	T	C	2: 180,278,668	T515A	probably damaging	Het
Rc3h1	G	T	1: 160,930,253	R47L	probably damaging	Het
Rfpl4b	T	A	10: 38,821,285	I107F	possibly damaging	Het
Rsbn1	T	C	3: 103,962,485	F754S	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Scn3a	T	C	2: 65,507,264	T630A	possibly damaging	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slco1a5	C	A	6: 142,248,816	C367F	probably damaging	Het
Slit1	A	G	19: 41,625,520		probably null	Het
Slit2	G	A	5: 48,220,991		probably null	Het
Snrnp40	G	T	4: 130,365,165	G122V	possibly damaging	Het
Stk16	T	A	1: 75,213,604	M111K	probably damaging	Het
Tbc1d2	T	C	4: 46,616,298	I477V	probably benign	Het
Tll1	T	A	8: 64,117,940	E199D	probably damaging	Het
Trhde	A	T	10: 114,588,502	D459E	probably benign	Het
Ttn	T	C	2: 76,711,537	R25375G	possibly damaging	Het
Tubgcp2	A	T	7: 139,998,788	M757K	possibly damaging	Het
Ubap1l	T	A	9: 65,372,055	V212D	possibly damaging	Het
Ubqln5	A	G	7: 104,129,425	V64A	possibly damaging	Het
Usp47	A	G	7: 112,109,997	M1337V	probably benign	Het
Vmn1r201	T	A	13: 22,475,239	Y208N	probably damaging	Het
Xkr8	C	T	4: 132,728,057	R335H	probably damaging	Het
Zbtb49	A	T	5: 38,216,526	C25S	probably damaging	Het
Zeb2	T	A	2: 44,997,788	N404I	probably damaging	Het

Other mutations in Olfr1474

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03256:Olfr1474	APN	19	13471267	missense	probably damaging	0.99
D605:Olfr1474	UTSW	19	13471157	nonsense	probably null
R0173:Olfr1474	UTSW	19	13471701	missense	probably benign	0.02
R1102:Olfr1474	UTSW	19	13471407	missense	probably damaging	0.97
R1515:Olfr1474	UTSW	19	13471680	missense	probably damaging	0.97
R1780:Olfr1474	UTSW	19	13471362	missense	probably benign	0.14
R2061:Olfr1474	UTSW	19	13471241	missense	probably damaging	0.98
R4016:Olfr1474	UTSW	19	13471197	missense	possibly damaging	0.95
R4485:Olfr1474	UTSW	19	13471555	missense	probably benign	0.08
R5119:Olfr1474	UTSW	19	13471546	missense	probably benign	0.00
R5150:Olfr1474	UTSW	19	13471430	missense	probably benign	0.01
R5156:Olfr1474	UTSW	19	13471673	missense	probably damaging	1.00
R5800:Olfr1474	UTSW	19	13471896	missense	probably benign	0.06
R5840:Olfr1474	UTSW	19	13471878	missense	probably benign	0.01
R5953:Olfr1474	UTSW	19	13471368	missense	possibly damaging	0.92
R5997:Olfr1474	UTSW	19	13471506	missense	probably benign	0.12
R6233:Olfr1474	UTSW	19	13471740	missense	probably damaging	1.00
R6488:Olfr1474	UTSW	19	13471617	missense	probably damaging	1.00
R6847:Olfr1474	UTSW	19	13471038	missense	probably benign	0.03
R6964:Olfr1474	UTSW	19	13471361	nonsense	probably null
R7214:Olfr1474	UTSW	19	13470973	start codon destroyed	probably null	1.00
R8001:Olfr1474	UTSW	19	13471422	missense	probably benign	0.03
R8035:Olfr1474	UTSW	19	13471899	missense	probably benign
R8129:Olfr1474	UTSW	19	13471144	missense	probably damaging	1.00
R9018:Olfr1474	UTSW	19	13471357	missense	possibly damaging	0.60
R9061:Olfr1474	UTSW	19	13471159	missense	probably damaging	0.98
R9065:Olfr1474	UTSW	19	13471306	missense	probably damaging	0.97
R9373:Olfr1474	UTSW	19	13471852	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGTTGTATTAGGCACCCC -3'
(R):5'- GTCCACCACCGAGAGATTACAG -3'

Sequencing Primer
(F):5'- AGTTGTATTAGGCACCCCTGGTATC -3'
(R):5'- CCGAGAGATTACAGAGGAAAAAGTAC -3'

Posted On

2016-11-21