Incidental Mutation 'R4986:Muc20'
ID446605
Institutional Source Beutler Lab
Gene Symbol Muc20
Ensembl Gene ENSMUSG00000035638
Gene Namemucin 20
Synonyms
MMRRC Submission 042580-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4986 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location32777419-32797435 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 32777635 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000096106] [ENSMUST00000115116]
Predicted Effect probably benign
Transcript: ENSMUST00000096106
SMART Domains Protein: ENSMUSP00000093813
Gene: ENSMUSG00000079620

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 37 65 N/A INTRINSIC
low complexity region 86 111 N/A INTRINSIC
internal_repeat_2 119 903 6.07e-127 PROSPERO
internal_repeat_1 164 987 3.47e-144 PROSPERO
internal_repeat_2 979 1875 6.07e-127 PROSPERO
internal_repeat_1 1193 2087 3.47e-144 PROSPERO
low complexity region 2090 2106 N/A INTRINSIC
low complexity region 2111 2119 N/A INTRINSIC
low complexity region 2186 2195 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2324 2332 N/A INTRINSIC
low complexity region 2344 2367 N/A INTRINSIC
NIDO 2458 2615 8.33e-67 SMART
AMOP 2614 2726 1.29e-47 SMART
VWD 2729 2910 4.23e-26 SMART
EGF_like 3134 3166 3.23e1 SMART
EGF_like 3176 3212 3.5e1 SMART
low complexity region 3237 3251 N/A INTRINSIC
EGF 3384 3421 1.4e0 SMART
transmembrane domain 3430 3452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115116
SMART Domains Protein: ENSMUSP00000110769
Gene: ENSMUSG00000035638

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
internal_repeat_1 114 146 2.16e-8 PROSPERO
internal_repeat_1 138 170 2.16e-8 PROSPERO
internal_repeat_2 144 161 4e-5 PROSPERO
low complexity region 171 204 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
internal_repeat_2 228 245 4e-5 PROSPERO
low complexity region 324 351 N/A INTRINSIC
low complexity region 376 385 N/A INTRINSIC
low complexity region 516 550 N/A INTRINSIC
low complexity region 574 593 N/A INTRINSIC
low complexity region 662 679 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131419
Predicted Effect probably benign
Transcript: ENSMUST00000135753
SMART Domains Protein: ENSMUSP00000119154
Gene: ENSMUSG00000079620

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
low complexity region 42 50 N/A INTRINSIC
low complexity region 117 126 N/A INTRINSIC
low complexity region 161 180 N/A INTRINSIC
low complexity region 255 263 N/A INTRINSIC
low complexity region 275 298 N/A INTRINSIC
NIDO 389 546 8.33e-67 SMART
AMOP 545 657 1.29e-47 SMART
VWD 660 841 4.23e-26 SMART
EGF_like 1065 1097 3.23e1 SMART
EGF_like 1107 1143 3.5e1 SMART
low complexity region 1168 1182 N/A INTRINSIC
EGF 1315 1352 1.4e0 SMART
transmembrane domain 1361 1383 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149773
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.2%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins secreted by many epithelial tissues to form an insoluble mucous barrier. The C-terminus of this family member associates with the multifunctional docking site of the MET proto-oncogene and suppresses activation of some downstream MET signaling cascades. The protein features a mucin tandem repeat domain that varies between two and six copies in most individuals. Multiple variants encoding different isoforms have been found for this gene. A related pseudogene, which is also located on chromosome 3, has been identified. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A T 14: 49,751,654 D619E probably damaging Het
Abcc9 A T 6: 142,627,591 C1005S probably benign Het
Ccdc34 T C 2: 110,017,869 M1T probably null Het
Ceacam5 T A 7: 17,757,833 N709K possibly damaging Het
Ces2f G A 8: 104,952,025 S298N probably benign Het
Defa30 T A 8: 21,135,416 Y65* probably null Het
Dock3 A C 9: 106,931,983 C1314G probably damaging Het
Emc2 A G 15: 43,511,784 M226V probably benign Het
Fat3 T C 9: 15,998,340 Y2122C probably damaging Het
Gad1 A G 2: 70,600,693 D560G probably benign Het
Gm9944 T C 4: 144,453,190 probably benign Het
Gpr137c A T 14: 45,246,286 probably null Het
Igf2bp2 C T 16: 22,070,306 probably null Het
Igsf10 T C 3: 59,328,606 T1385A probably benign Het
Itpr2 T A 6: 146,240,342 N1734I probably damaging Het
Kbtbd6 A G 14: 79,452,609 H248R probably damaging Het
Macf1 C T 4: 123,391,121 R5650Q probably damaging Het
Mdh1 A G 11: 21,558,545 F266L possibly damaging Het
Mecom G T 3: 29,980,699 P466Q probably damaging Het
Olfr1151 T A 2: 87,857,514 L113Q probably damaging Het
Olfr1265 A T 2: 90,037,428 N170Y probably damaging Het
Osmr A G 15: 6,816,580 probably null Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Sacs T A 14: 61,213,043 Y4179* probably null Het
Sept11 T C 5: 93,161,241 V203A probably damaging Het
Skint9 T A 4: 112,391,713 T173S probably benign Het
Slain1 A T 14: 103,688,105 R296S probably damaging Het
Slc36a3 T A 11: 55,146,766 *93C probably null Het
Sp110 G A 1: 85,591,760 P116S probably benign Het
Srl T C 16: 4,496,782 Y332C probably benign Het
Ubtf G A 11: 102,314,174 H95Y probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Ybx1 C T 4: 119,282,430 V123I probably damaging Het
Zfp944 A T 17: 22,339,230 H345Q probably damaging Het
Zfp993 T A 4: 146,657,557 F113I probably benign Het
Other mutations in Muc20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01953:Muc20 APN 16 32793703 missense probably benign 0.10
IGL02016:Muc20 APN 16 32797352 missense possibly damaging 0.46
IGL02092:Muc20 APN 16 32794272 missense probably damaging 0.99
IGL02415:Muc20 APN 16 32794681 missense unknown
R6669_muc20_072 UTSW 16 32793937 missense possibly damaging 0.94
R0552:Muc20 UTSW 16 32793930 missense probably damaging 0.98
R0629:Muc20 UTSW 16 32793421 missense possibly damaging 0.66
R0669:Muc20 UTSW 16 32794480 missense unknown
R0725:Muc20 UTSW 16 32793488 missense probably benign 0.05
R1676:Muc20 UTSW 16 32794279 missense probably damaging 1.00
R1771:Muc20 UTSW 16 32793852 missense probably damaging 0.97
R1778:Muc20 UTSW 16 32794141 missense possibly damaging 0.49
R1967:Muc20 UTSW 16 32794242 missense probably benign 0.03
R2104:Muc20 UTSW 16 32794177 missense probably damaging 0.99
R3054:Muc20 UTSW 16 32779029 missense probably benign 0.18
R4704:Muc20 UTSW 16 32779074 missense possibly damaging 0.70
R4893:Muc20 UTSW 16 32794672 missense possibly damaging 0.66
R5191:Muc20 UTSW 16 32794476 missense unknown
R5195:Muc20 UTSW 16 32794476 missense unknown
R5875:Muc20 UTSW 16 32793819 missense possibly damaging 0.93
R5931:Muc20 UTSW 16 32794574 missense possibly damaging 0.81
R6434:Muc20 UTSW 16 32794806 missense probably benign 0.01
R6523:Muc20 UTSW 16 32793450 missense possibly damaging 0.90
R6580:Muc20 UTSW 16 32793489 missense possibly damaging 0.77
R6669:Muc20 UTSW 16 32793937 missense possibly damaging 0.94
R7028:Muc20 UTSW 16 32794246 missense probably benign 0.03
R7681:Muc20 UTSW 16 32793619 missense probably benign 0.34
R7722:Muc20 UTSW 16 32797386 missense probably benign 0.00
W0251:Muc20 UTSW 16 32793853 missense possibly damaging 0.91
X0011:Muc20 UTSW 16 32793252 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCATCTGCAGAGGACAGACG -3'
(R):5'- TGAAGGATGTGTAAGCTACTGCAAG -3'

Sequencing Primer
(F):5'- TCAATAAGACGCTGTTGGCC -3'
(R):5'- ATGTGTAAGCTACTGCAAGGTCCC -3'
Posted On2016-11-22