Incidental Mutation 'R4994:Dzank1'
ID 446625
Institutional Source Beutler Lab
Gene Symbol Dzank1
Ensembl Gene ENSMUSG00000037259
Gene Name double zinc ribbon and ankyrin repeat domains 1
Synonyms 2810039F03Rik, 6330439K17Rik, Ankrd64
MMRRC Submission 042588-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4994 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 144312477-144369334 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 144364486 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 37 (D37A)
Ref Sequence ENSEMBL: ENSMUSP00000133177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081982] [ENSMUST00000163701]
AlphaFold Q8C008
Predicted Effect probably damaging
Transcript: ENSMUST00000081982
AA Change: D37A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080643
Gene: ENSMUSG00000037259
AA Change: D37A

DomainStartEndE-ValueType
Pfam:CHB_HEX_C 11 99 1.1e-16 PFAM
Pfam:CHB_HEX_C_1 20 97 4.5e-18 PFAM
Pfam:Fn3_assoc 32 100 1.6e-17 PFAM
ZnF_RBZ 268 292 5.44e0 SMART
ZnF_RBZ 307 331 2.55e0 SMART
Blast:ZnF_RBZ 355 378 1e-7 BLAST
ZnF_RBZ 385 409 3.13e0 SMART
low complexity region 591 604 N/A INTRINSIC
ANK 631 662 2.97e2 SMART
ANK 666 695 2.83e0 SMART
Blast:ANK 700 731 7e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150816
Predicted Effect probably damaging
Transcript: ENSMUST00000163701
AA Change: D37A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133177
Gene: ENSMUSG00000037259
AA Change: D37A

DomainStartEndE-ValueType
Pfam:CHB_HEX_C 12 99 1.5e-17 PFAM
Pfam:CHB_HEX_C_1 21 97 8.5e-17 PFAM
Pfam:Fn3_assoc 32 100 3.7e-18 PFAM
ZnF_RBZ 269 293 5.44e0 SMART
ZnF_RBZ 308 332 2.55e0 SMART
Blast:ZnF_RBZ 356 379 1e-7 BLAST
ZnF_RBZ 386 410 3.13e0 SMART
low complexity region 592 605 N/A INTRINSIC
ANK 632 663 2.97e2 SMART
ANK 667 696 2.83e0 SMART
Blast:ANK 701 732 7e-12 BLAST
Meta Mutation Damage Score 0.1366 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains two ankyrin repeat-encoding regions. Ankyrin repeats are tandemly repeated modules of about 33 amino acids described as L-shaped structures consisting of a beta-hairpin and two alpha-helices. Ankyrin repeats occur in a large number of functionally diverse proteins, mainly from eukaryotes, and are known to function as protein-protein interaction domains. Alternative splicing has been observed for this gene but the full-length nature of additional variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 73,208,962 (GRCm39) E364G probably benign Het
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Abcb4 A G 5: 8,978,524 (GRCm39) T557A probably damaging Het
Acadm C T 3: 153,635,221 (GRCm39) E298K probably damaging Het
Adrb3 T C 8: 27,717,855 (GRCm39) probably null Het
Aldh1b1 A G 4: 45,803,128 (GRCm39) Y222C possibly damaging Het
Ankrd6 A G 4: 32,860,387 (GRCm39) Y19H probably damaging Het
Arhgap21 T A 2: 20,854,701 (GRCm39) T1554S probably benign Het
BC043934 T C 9: 96,319,173 (GRCm39) noncoding transcript Het
Birc6 A G 17: 74,901,319 (GRCm39) probably benign Het
Blm A C 7: 80,108,573 (GRCm39) F1357C probably benign Het
Cd209a T C 8: 3,797,713 (GRCm39) probably null Het
Cdk7 G A 13: 100,854,103 (GRCm39) H129Y probably damaging Het
Clec14a G T 12: 58,315,070 (GRCm39) P184Q probably damaging Het
Cma1 T A 14: 56,179,128 (GRCm39) I243F probably damaging Het
Cntnap3 G T 13: 64,909,798 (GRCm39) T769K possibly damaging Het
Col5a1 A C 2: 27,922,751 (GRCm39) K273T possibly damaging Het
Csnk1e A G 15: 79,309,129 (GRCm39) Y266H probably damaging Het
Cyb5d1 A G 11: 69,284,597 (GRCm39) L185S probably damaging Het
Dennd5b T C 6: 148,942,998 (GRCm39) probably null Het
Dipk2a C A 9: 94,419,486 (GRCm39) R148L probably benign Het
Drp2 G A X: 133,342,065 (GRCm39) R567H probably damaging Homo
Echdc2 A G 4: 108,022,825 (GRCm39) I34V probably benign Het
Esm1 A T 13: 113,349,965 (GRCm39) R128S probably benign Het
Fbh1 T A 2: 11,769,041 (GRCm39) I251F probably damaging Het
Fbrsl1 A G 5: 110,595,817 (GRCm39) S73P probably damaging Het
Fbxo6 A T 4: 148,233,948 (GRCm39) S49R probably damaging Het
Gm17093 A T 14: 44,756,779 (GRCm39) Q82L probably damaging Het
Hmcn2 T C 2: 31,348,067 (GRCm39) probably null Het
Hspa4l C A 3: 40,700,081 (GRCm39) probably benign Het
Il3ra G A 14: 14,351,080 (GRCm38) A201T probably benign Het
Irx5 T A 8: 93,087,409 (GRCm39) V447E probably damaging Het
Kif14 G T 1: 136,410,697 (GRCm39) L668F probably damaging Het
Lag3 T A 6: 124,881,416 (GRCm39) R519W unknown Het
Lgr4 A G 2: 109,842,283 (GRCm39) N756S probably damaging Het
Lingo4 A G 3: 94,309,848 (GRCm39) H262R probably benign Het
Lingo4 T A 3: 94,310,308 (GRCm39) H415Q probably benign Het
Lkaaear1 C A 2: 181,339,376 (GRCm39) G25* probably null Het
Maco1 A G 4: 134,555,610 (GRCm39) Y288H probably damaging Het
Marf1 T C 16: 13,932,095 (GRCm39) K1641E probably benign Het
Mtfmt T C 9: 65,351,133 (GRCm39) probably benign Het
Mtif3 G A 5: 146,893,598 (GRCm39) T203M probably benign Het
Mycbp2 A G 14: 103,407,430 (GRCm39) I2740T probably benign Het
Nrdc A G 4: 108,903,809 (GRCm39) T720A probably benign Het
Or2d2 T C 7: 106,728,271 (GRCm39) T110A probably benign Het
Peak1 T A 9: 56,148,560 (GRCm39) D32V possibly damaging Het
Pigr G A 1: 130,769,554 (GRCm39) D122N probably benign Het
Plekhg3 A G 12: 76,612,311 (GRCm39) R391G possibly damaging Het
Ppfia3 T C 7: 44,990,542 (GRCm39) D919G probably damaging Het
Pramel23 T A 4: 143,424,939 (GRCm39) Q168L possibly damaging Het
Rnase2b T A 14: 51,400,208 (GRCm39) D96E possibly damaging Het
Rsf1 CGGCGGC CGGCGGCCGCGGCGGC 7: 97,229,130 (GRCm39) probably benign Het
Rsf1 G GACGGCGGCT 7: 97,229,116 (GRCm39) probably benign Het
Serpina3f A G 12: 104,186,615 (GRCm39) T394A probably benign Het
Six3 A G 17: 85,928,720 (GRCm39) N18S possibly damaging Het
Slc12a5 T A 2: 164,825,285 (GRCm39) probably null Het
Slc35f6 A G 5: 30,805,427 (GRCm39) N21S probably damaging Het
Slc39a6 A T 18: 24,729,351 (GRCm39) I454N probably damaging Het
Slc40a1 T A 1: 45,948,824 (GRCm39) E485D probably damaging Het
Sort1 G A 3: 108,235,385 (GRCm39) C255Y probably damaging Het
Stab2 T A 10: 86,785,771 (GRCm39) T624S probably benign Het
Stk33 T A 7: 108,939,605 (GRCm39) I99L probably benign Het
Taf4b T A 18: 15,031,100 (GRCm39) I828N probably damaging Het
Terf2 T C 8: 107,803,110 (GRCm39) probably benign Het
Timd4 C T 11: 46,706,344 (GRCm39) R49C probably damaging Het
Tpte T C 8: 22,808,362 (GRCm39) S166P probably benign Het
Trabd2b T C 4: 114,264,052 (GRCm39) L13P probably benign Het
Trappc11 A T 8: 47,975,476 (GRCm39) Y247* probably null Het
Trnt1 C T 6: 106,755,853 (GRCm39) Q303* probably null Het
Tspyl5 T A 15: 33,687,201 (GRCm39) Q248L possibly damaging Het
Ubxn7 A T 16: 32,200,322 (GRCm39) K337N probably damaging Het
Unc13a T A 8: 72,095,816 (GRCm39) I1234F probably benign Het
Vmn1r127 A T 7: 21,052,943 (GRCm39) F282I probably damaging Het
Wdhd1 A T 14: 47,506,111 (GRCm39) probably null Het
Zfp605 A G 5: 110,275,352 (GRCm39) K157E probably damaging Het
Zhx2 T A 15: 57,684,755 (GRCm39) D41E probably benign Het
Other mutations in Dzank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Dzank1 APN 2 144,323,645 (GRCm39) nonsense probably null
IGL00955:Dzank1 APN 2 144,332,094 (GRCm39) missense probably benign 0.22
IGL01888:Dzank1 APN 2 144,318,074 (GRCm39) splice site probably null
IGL02108:Dzank1 APN 2 144,348,143 (GRCm39) missense probably benign 0.02
IGL02979:Dzank1 APN 2 144,330,658 (GRCm39) missense probably damaging 1.00
BB008:Dzank1 UTSW 2 144,323,614 (GRCm39) missense probably benign 0.00
BB018:Dzank1 UTSW 2 144,323,614 (GRCm39) missense probably benign 0.00
PIT4466001:Dzank1 UTSW 2 144,325,293 (GRCm39) missense probably benign 0.00
R0388:Dzank1 UTSW 2 144,318,026 (GRCm39) missense possibly damaging 0.86
R0603:Dzank1 UTSW 2 144,353,432 (GRCm39) missense probably benign 0.04
R1052:Dzank1 UTSW 2 144,355,365 (GRCm39) missense probably benign
R1386:Dzank1 UTSW 2 144,333,751 (GRCm39) missense probably benign 0.05
R1529:Dzank1 UTSW 2 144,324,108 (GRCm39) missense probably benign 0.01
R1634:Dzank1 UTSW 2 144,323,589 (GRCm39) missense probably benign 0.01
R2761:Dzank1 UTSW 2 144,355,369 (GRCm39) missense probably benign
R4024:Dzank1 UTSW 2 144,324,147 (GRCm39) missense probably benign
R4279:Dzank1 UTSW 2 144,333,765 (GRCm39) missense probably benign 0.00
R4324:Dzank1 UTSW 2 144,330,618 (GRCm39) missense possibly damaging 0.95
R4516:Dzank1 UTSW 2 144,352,042 (GRCm39) intron probably benign
R4713:Dzank1 UTSW 2 144,333,724 (GRCm39) missense probably benign 0.13
R4782:Dzank1 UTSW 2 144,346,319 (GRCm39) missense probably damaging 1.00
R5157:Dzank1 UTSW 2 144,325,332 (GRCm39) missense probably damaging 0.98
R5514:Dzank1 UTSW 2 144,323,605 (GRCm39) missense probably benign 0.01
R5580:Dzank1 UTSW 2 144,348,098 (GRCm39) missense probably damaging 1.00
R5635:Dzank1 UTSW 2 144,325,327 (GRCm39) missense probably damaging 1.00
R5793:Dzank1 UTSW 2 144,348,144 (GRCm39) missense probably benign 0.14
R5820:Dzank1 UTSW 2 144,355,408 (GRCm39) missense probably damaging 1.00
R5976:Dzank1 UTSW 2 144,343,409 (GRCm39) missense probably damaging 1.00
R6935:Dzank1 UTSW 2 144,318,014 (GRCm39) missense possibly damaging 0.64
R6980:Dzank1 UTSW 2 144,332,056 (GRCm39) missense possibly damaging 0.87
R7331:Dzank1 UTSW 2 144,332,190 (GRCm39) missense probably benign 0.17
R7691:Dzank1 UTSW 2 144,348,091 (GRCm39) missense probably damaging 1.00
R7814:Dzank1 UTSW 2 144,364,484 (GRCm39) missense probably damaging 1.00
R7879:Dzank1 UTSW 2 144,333,718 (GRCm39) missense probably benign 0.01
R7931:Dzank1 UTSW 2 144,323,614 (GRCm39) missense probably benign 0.00
R8127:Dzank1 UTSW 2 144,330,736 (GRCm39) missense probably damaging 1.00
R8192:Dzank1 UTSW 2 144,332,145 (GRCm39) missense probably benign 0.05
R8314:Dzank1 UTSW 2 144,344,878 (GRCm39) missense probably damaging 1.00
R8944:Dzank1 UTSW 2 144,333,729 (GRCm39) missense probably benign 0.00
R9025:Dzank1 UTSW 2 144,318,012 (GRCm39) missense probably benign 0.04
R9096:Dzank1 UTSW 2 144,316,882 (GRCm39) missense possibly damaging 0.62
R9097:Dzank1 UTSW 2 144,316,882 (GRCm39) missense possibly damaging 0.62
R9108:Dzank1 UTSW 2 144,364,391 (GRCm39) missense probably benign 0.00
R9261:Dzank1 UTSW 2 144,355,344 (GRCm39) missense probably benign 0.20
R9410:Dzank1 UTSW 2 144,324,050 (GRCm39) critical splice donor site probably null
R9418:Dzank1 UTSW 2 144,355,408 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATTGATTCTCCCAAGAACTG -3'
(R):5'- TGAGCTCATTCACACAGAGTAC -3'

Sequencing Primer
(F):5'- TTTATCCCAGCACTCAGGAGG -3'
(R):5'- CACTTACTCTGTGTGTGTG -3'
Posted On 2016-11-30