Mutagenetix > Incidental Mutation

Incidental Mutation 'R5776:Raph1'

446673

Institutional Source

Beutler Lab

Gene Symbol

Raph1

Ensembl Gene

ENSMUSG00000026014

Gene Name

Ras association (RalGDS/AF-6) and pleckstrin homology domains 1

Synonyms

C730009O10Rik, Lpd, 9430025M21Rik, lamellipodin

MMRRC Submission

043375-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R5776 (G1)

Quality Score

196

Status

Validated

Chromosome

Chromosomal Location

60482292-60567104 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

G to A at 60490156 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485]

AlphaFold

F2Z3U3

Predicted Effect

probably benign
Transcript: ENSMUST00000027168

SMART Domains

Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000090293

SMART Domains

Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000140485
AA Change: P649S

SMART Domains

Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: P649S

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
RA	270	356	1.63e-13	SMART
PH	398	508	3.38e-11	SMART
low complexity region	529	552	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000182085

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188511

Meta Mutation Damage Score

0.1291

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.3%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	A	T	6: 23,107,650	M378K	possibly damaging	Het
Abca17	A	G	17: 24,295,158	V857A	probably benign	Het
Abca9	C	T	11: 110,107,460		probably null	Het
Adam22	T	C	5: 8,127,361	K583E	probably benign	Het
Akr1c13	T	C	13: 4,194,187	F80L	probably damaging	Het
Apob	A	T	12: 8,006,149	I1511F	possibly damaging	Het
Cfh	C	A	1: 140,144,023	R291I	possibly damaging	Het
Col1a1	C	T	11: 94,949,724	S1114F	unknown	Het
Ctsj	T	C	13: 61,003,142	D168G	probably damaging	Het
Erf	T	C	7: 25,246,109	D79G	probably damaging	Het
Extl1	T	C	4: 134,357,772	N629S	possibly damaging	Het
Fbxo9	T	C	9: 78,095,187	E204G	probably damaging	Het
Fdx1l	C	A	9: 21,073,482	V9L	possibly damaging	Het
Gfer	G	T	17: 24,696,053	S5R	probably benign	Het
Gm15931	A	T	7: 4,281,565		noncoding transcript	Het
Gm6309	T	A	5: 146,168,881	I158F	possibly damaging	Het
Gm7247	C	T	14: 51,364,348	S26F	probably benign	Het
Gm8251	T	C	1: 44,056,505	E1811G	possibly damaging	Het
Hacl1	A	T	14: 31,622,871	N234K	possibly damaging	Het
Hcn3	C	T	3: 89,148,105	A612T	probably benign	Het
Hectd1	T	A	12: 51,764,114	E1679D	possibly damaging	Het
Hipk4	T	C	7: 27,528,980	L285P	probably damaging	Het
Igsf3	G	A	3: 101,425,480	V25I	probably benign	Het
Jade1	A	G	3: 41,613,792	H765R	probably benign	Het
Kcnv1	T	C	15: 45,114,567	D25G	unknown	Het
Klhl3	A	G	13: 58,005,184	S586P	probably benign	Het
L3mbtl2	A	G	15: 81,684,871	D582G	probably damaging	Het
Matn2	G	A	15: 34,431,619	C835Y	probably damaging	Het
Mgea5	T	C	19: 45,771,924	E265G	probably damaging	Het
Naa15	A	C	3: 51,460,026	D490A	probably damaging	Het
Nab2	T	A	10: 127,664,329	Y298F	probably damaging	Het
Nipsnap1	T	A	11: 4,888,919	M115K	probably benign	Het
Nlrp5-ps	T	C	7: 14,592,724		noncoding transcript	Het
Nol4l	T	G	2: 153,417,821	Q211P	probably damaging	Het
Olfr427	A	T	1: 174,099,773	H105L	probably damaging	Het
Olfr625-ps1	T	A	7: 103,683,039	M97K	probably damaging	Het
Pkhd1	T	C	1: 20,209,185	K2970E	possibly damaging	Het
Plin4	T	C	17: 56,104,983	T683A	probably damaging	Het
Ppm1g	T	C	5: 31,205,110	D282G	probably benign	Het
Ppp6r3	A	G	19: 3,526,901	S10P	possibly damaging	Het
Rc3h2	A	G	2: 37,378,313	V935A	possibly damaging	Het
Reg4	T	A	3: 98,233,028	D108E	possibly damaging	Het
Saraf	T	A	8: 34,165,450	Y228N	probably damaging	Het
Sctr	T	C	1: 120,056,407	S357P	probably damaging	Het
Sec22b	A	T	3: 97,914,568	N139Y	probably damaging	Het
Sgsm1	T	A	5: 113,250,957	I1037F	probably damaging	Het
Skint5	A	C	4: 113,763,503	S671R	unknown	Het
Slc38a3	C	A	9: 107,658,749	E62*	probably null	Het
Slfn14	C	T	11: 83,283,599	E189K	probably damaging	Het
Sox21	A	G	14: 118,235,244	L131P	probably damaging	Het
Stip1	A	G	19: 7,022,025		probably null	Het
Stx16	G	A	2: 174,093,499	G156R	probably damaging	Het
Susd1	T	C	4: 59,315,363		probably benign	Het
Tdrd7	T	A	4: 46,005,689	D498E	probably benign	Het
Tln2	C	T	9: 67,258,250	E1053K	probably damaging	Het
Trav6-4	A	G	14: 53,454,754	D103G	probably damaging	Het
Txndc15	A	G	13: 55,718,107	E128G	probably benign	Het
Vmn2r22	A	T	6: 123,637,714	W306R	probably damaging	Het
Yjefn3	A	T	8: 69,889,471	L33Q	probably damaging	Het
Zfp641	T	C	15: 98,289,010	D244G	probably damaging	Het

Other mutations in Raph1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02300:Raph1	APN	1	60525947	missense	possibly damaging	0.76
IGL02900:Raph1	APN	1	60502863	missense	probably damaging	1.00
FR4976:Raph1	UTSW	1	60489267	intron	probably benign
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0227:Raph1	UTSW	1	60525977	missense	probably benign	0.00
R0387:Raph1	UTSW	1	60510496	intron	probably benign
R0607:Raph1	UTSW	1	60525869	missense	probably damaging	1.00
R1740:Raph1	UTSW	1	60519024	nonsense	probably null
R2274:Raph1	UTSW	1	60498500	missense	probably damaging	1.00
R3108:Raph1	UTSW	1	60493386	missense	probably benign	0.01
R3977:Raph1	UTSW	1	60498523	missense	probably benign	0.39
R4260:Raph1	UTSW	1	60502965	missense	possibly damaging	0.94
R4487:Raph1	UTSW	1	60502869	missense	possibly damaging	0.68
R4721:Raph1	UTSW	1	60503001	unclassified	probably benign
R4782:Raph1	UTSW	1	60489114	missense	probably damaging	1.00
R5027:Raph1	UTSW	1	60496277	missense	probably damaging	1.00
R5037:Raph1	UTSW	1	60496222	splice site	probably null
R5106:Raph1	UTSW	1	60533300	missense	probably damaging	1.00
R5506:Raph1	UTSW	1	60493498	intron	probably benign
R5510:Raph1	UTSW	1	60522946	unclassified	probably benign
R5587:Raph1	UTSW	1	60498473	missense	probably damaging	1.00
R5591:Raph1	UTSW	1	60501746	unclassified	probably benign
R5619:Raph1	UTSW	1	60490255	intron	probably benign
R5802:Raph1	UTSW	1	60488673	missense	possibly damaging	0.81
R6742:Raph1	UTSW	1	60525720	missense	probably damaging	0.97
R7122:Raph1	UTSW	1	60525977	missense	probably benign	0.10
R7219:Raph1	UTSW	1	60502873	missense	unknown
R7251:Raph1	UTSW	1	60489868	missense	unknown
R7254:Raph1	UTSW	1	60499608	missense	unknown
R7732:Raph1	UTSW	1	60533288	missense	possibly damaging	0.82
R7979:Raph1	UTSW	1	60525989	missense	probably benign	0.00
R7986:Raph1	UTSW	1	60496286	missense
R8167:Raph1	UTSW	1	60490111	missense	unknown
R8168:Raph1	UTSW	1	60499620	missense	unknown
R8399:Raph1	UTSW	1	60489318	missense	unknown
R9036:Raph1	UTSW	1	60502965	missense	unknown
R9146:Raph1	UTSW	1	60518978	critical splice donor site	probably null
R9338:Raph1	UTSW	1	60490141	missense	unknown
R9381:Raph1	UTSW	1	60501800	missense	unknown
R9383:Raph1	UTSW	1	60525670	missense	unknown
R9399:Raph1	UTSW	1	60525995	missense	probably benign
R9454:Raph1	UTSW	1	60489594	missense	unknown
R9561:Raph1	UTSW	1	60525728	missense	possibly damaging	0.49
RF018:Raph1	UTSW	1	60489267	intron	probably benign
RF022:Raph1	UTSW	1	60489267	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- TTTGAGCCTTGGACTGTGAAGC -3'
(R):5'- GCCAAAGCTTACCTCTGTAACTG -3'

Sequencing Primer
(F):5'- CCTTGGACTGTGAAGCCAAAG -3'
(R):5'- CAAAGCTTACCTCTGTAACTGTTGTG -3'

Posted On

2016-12-15