Mutagenetix > Incidental Mutations

Incidental Mutation 'R5776:Susd1'

446689

Institutional Source

Beutler Lab

Gene Symbol

Susd1

Ensembl Gene

ENSMUSG00000038578

Gene Name

sushi domain containing 1

Synonyms

Gm12528

MMRRC Submission

043375-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R5776 (G1)

Quality Score

220

Status

Validated

Chromosome

Chromosomal Location

59314683-59438633 bp(-) (GRCm38)

Type of Mutation

utr 3 prime

DNA Base Change (assembly)

T to C at 59315363 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000103168 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040166] [ENSMUST00000107544]

Predicted Effect

probably benign
Transcript: ENSMUST00000040166

SMART Domains

Protein: ENSMUSP00000048201
Gene: ENSMUSG00000038578

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	16	30	N/A	INTRINSIC
EGF	43	77	1.36e1	SMART
EGF_CA	78	129	2.92e-7	SMART
EGF_CA	130	180	2.22e-12	SMART
CCP	184	239	7.87e-9	SMART
CCP	244	299	5.48e-8	SMART
Blast:FN3	306	379	2e-6	BLAST
Blast:FN3	459	580	8e-50	BLAST
transmembrane domain	729	751	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107544

SMART Domains

Protein: ENSMUSP00000103168
Gene: ENSMUSG00000038578

Domain	Start	End	E-Value	Type
EGF	28	76	2.02e-1	SMART
EGF_CA	77	127	2.22e-12	SMART
CCP	131	186	7.87e-9	SMART
CCP	191	246	5.48e-8	SMART
Blast:FN3	253	326	2e-6	BLAST
Blast:FN3	406	527	4e-50	BLAST
transmembrane domain	676	698	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136942

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.3%

Validation Efficiency

98% (64/65)

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	A	T	6: 23,107,650	M378K	possibly damaging	Het
Abca17	A	G	17: 24,295,158	V857A	probably benign	Het
Abca9	C	T	11: 110,107,460		probably null	Het
Adam22	T	C	5: 8,127,361	K583E	probably benign	Het
Akr1c13	T	C	13: 4,194,187	F80L	probably damaging	Het
Apob	A	T	12: 8,006,149	I1511F	possibly damaging	Het
Cfh	C	A	1: 140,144,023	R291I	possibly damaging	Het
Col1a1	C	T	11: 94,949,724	S1114F	unknown	Het
Ctsj	T	C	13: 61,003,142	D168G	probably damaging	Het
Erf	T	C	7: 25,246,109	D79G	probably damaging	Het
Extl1	T	C	4: 134,357,772	N629S	possibly damaging	Het
Fbxo9	T	C	9: 78,095,187	E204G	probably damaging	Het
Fdx1l	C	A	9: 21,073,482	V9L	possibly damaging	Het
Gfer	G	T	17: 24,696,053	S5R	probably benign	Het
Gm15931	A	T	7: 4,281,565		noncoding transcript	Het
Gm6309	T	A	5: 146,168,881	I158F	possibly damaging	Het
Gm7247	C	T	14: 51,364,348	S26F	probably benign	Het
Gm8251	T	C	1: 44,056,505	E1811G	possibly damaging	Het
Hacl1	A	T	14: 31,622,871	N234K	possibly damaging	Het
Hcn3	C	T	3: 89,148,105	A612T	probably benign	Het
Hectd1	T	A	12: 51,764,114	E1679D	possibly damaging	Het
Hipk4	T	C	7: 27,528,980	L285P	probably damaging	Het
Igsf3	G	A	3: 101,425,480	V25I	probably benign	Het
Jade1	A	G	3: 41,613,792	H765R	probably benign	Het
Kcnv1	T	C	15: 45,114,567	D25G	unknown	Het
Klhl3	A	G	13: 58,005,184	S586P	probably benign	Het
L3mbtl2	A	G	15: 81,684,871	D582G	probably damaging	Het
Matn2	G	A	15: 34,431,619	C835Y	probably damaging	Het
Mgea5	T	C	19: 45,771,924	E265G	probably damaging	Het
Naa15	A	C	3: 51,460,026	D490A	probably damaging	Het
Nab2	T	A	10: 127,664,329	Y298F	probably damaging	Het
Nipsnap1	T	A	11: 4,888,919	M115K	probably benign	Het
Nlrp5-ps	T	C	7: 14,592,724		noncoding transcript	Het
Nol4l	T	G	2: 153,417,821	Q211P	probably damaging	Het
Olfr427	A	T	1: 174,099,773	H105L	probably damaging	Het
Olfr625-ps1	T	A	7: 103,683,039	M97K	probably damaging	Het
Pkhd1	T	C	1: 20,209,185	K2970E	possibly damaging	Het
Plin4	T	C	17: 56,104,983	T683A	probably damaging	Het
Ppm1g	T	C	5: 31,205,110	D282G	probably benign	Het
Ppp6r3	A	G	19: 3,526,901	S10P	possibly damaging	Het
Raph1	G	A	1: 60,490,156		probably benign	Het
Rc3h2	A	G	2: 37,378,313	V935A	possibly damaging	Het
Reg4	T	A	3: 98,233,028	D108E	possibly damaging	Het
Saraf	T	A	8: 34,165,450	Y228N	probably damaging	Het
Sctr	T	C	1: 120,056,407	S357P	probably damaging	Het
Sec22b	A	T	3: 97,914,568	N139Y	probably damaging	Het
Sgsm1	T	A	5: 113,250,957	I1037F	probably damaging	Het
Skint5	A	C	4: 113,763,503	S671R	unknown	Het
Slc38a3	C	A	9: 107,658,749	E62*	probably null	Het
Slfn14	C	T	11: 83,283,599	E189K	probably damaging	Het
Sox21	A	G	14: 118,235,244	L131P	probably damaging	Het
Stip1	A	G	19: 7,022,025		probably null	Het
Stx16	G	A	2: 174,093,499	G156R	probably damaging	Het
Tdrd7	T	A	4: 46,005,689	D498E	probably benign	Het
Tln2	C	T	9: 67,258,250	E1053K	probably damaging	Het
Trav6-4	A	G	14: 53,454,754	D103G	probably damaging	Het
Txndc15	A	G	13: 55,718,107	E128G	probably benign	Het
Vmn2r22	A	T	6: 123,637,714	W306R	probably damaging	Het
Yjefn3	A	T	8: 69,889,471	L33Q	probably damaging	Het
Zfp641	T	C	15: 98,289,010	D244G	probably damaging	Het

Other mutations in Susd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01630:Susd1	APN	4	59365817	missense	possibly damaging	0.85
IGL01705:Susd1	APN	4	59332931	splice site	probably benign
IGL01727:Susd1	APN	4	59412329	splice site	probably benign
IGL02015:Susd1	APN	4	59315745	missense	possibly damaging	0.86
IGL02102:Susd1	APN	4	59369636	missense	possibly damaging	0.70
IGL02351:Susd1	APN	4	59427985	nonsense	probably null
IGL02358:Susd1	APN	4	59427985	nonsense	probably null
IGL03210:Susd1	APN	4	59333035	critical splice acceptor site	probably null
IGL03258:Susd1	APN	4	59379655	missense	possibly damaging	0.73
R0612:Susd1	UTSW	4	59390561	splice site	probably benign
R0719:Susd1	UTSW	4	59329506	missense	possibly damaging	0.56
R0722:Susd1	UTSW	4	59379749	missense	possibly damaging	0.73
R1355:Susd1	UTSW	4	59424114	missense	possibly damaging	0.86
R1672:Susd1	UTSW	4	59411395	missense	probably damaging	0.98
R1677:Susd1	UTSW	4	59424089	missense	possibly damaging	0.85
R1921:Susd1	UTSW	4	59412191	missense	probably benign	0.03
R1933:Susd1	UTSW	4	59351695	missense	possibly damaging	0.72
R1998:Susd1	UTSW	4	59349925	missense	probably benign	0.03
R2202:Susd1	UTSW	4	59349843	missense	possibly damaging	0.96
R2203:Susd1	UTSW	4	59349843	missense	possibly damaging	0.96
R2204:Susd1	UTSW	4	59349843	missense	possibly damaging	0.96
R2329:Susd1	UTSW	4	59379715	missense	possibly damaging	0.85
R2510:Susd1	UTSW	4	59349855	missense	possibly damaging	0.86
R4512:Susd1	UTSW	4	59329491	missense	possibly damaging	0.96
R4732:Susd1	UTSW	4	59428029	missense	possibly damaging	0.53
R4733:Susd1	UTSW	4	59428029	missense	possibly damaging	0.53
R4969:Susd1	UTSW	4	59351679	missense	probably benign	0.04
R5121:Susd1	UTSW	4	59379657	missense	possibly damaging	0.73
R5548:Susd1	UTSW	4	59369577	missense	probably benign	0.05
R5747:Susd1	UTSW	4	59424108	missense	probably damaging	0.98
R5875:Susd1	UTSW	4	59412203	missense	possibly damaging	0.71
R6056:Susd1	UTSW	4	59379687	missense	possibly damaging	0.53
R6081:Susd1	UTSW	4	59411359	missense	possibly damaging	0.86
R7018:Susd1	UTSW	4	59390627	missense	probably benign	0.44
R7122:Susd1	UTSW	4	59411318	nonsense	probably null
R7161:Susd1	UTSW	4	59329581	missense	possibly damaging	0.85
R7172:Susd1	UTSW	4	59315420	splice site	probably null
R7891:Susd1	UTSW	4	59349915	missense	possibly damaging	0.85
R7974:Susd1	UTSW	4	59349915	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- TTGGACATGAGTCTTGAGGTCAC -3'
(R):5'- GAATAGTGATGACCACCCCATC -3'

Sequencing Primer
(F):5'- TGAGGTCACAGATATACAACTGATCC -3'
(R):5'- TGATGACCACCCCATCAGTCC -3'

Posted On

2016-12-15