Incidental Mutation 'R5777:Tex35'
ID446736
Institutional Source Beutler Lab
Gene Symbol Tex35
Ensembl Gene ENSMUSG00000026592
Gene Nametestis expressed 35
Synonyms1700057K13Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5777 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location157099139-157108680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 157107207 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 46 (M46V)
Ref Sequence ENSEMBL: ENSMUSP00000139460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027884] [ENSMUST00000118207] [ENSMUST00000119526] [ENSMUST00000121911] [ENSMUST00000148649] [ENSMUST00000187546]
Predicted Effect probably benign
Transcript: ENSMUST00000027884
AA Change: M46V

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027884
Gene: ENSMUSG00000026592
AA Change: M46V

DomainStartEndE-ValueType
Pfam:DUF4546 1 201 1.7e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118207
AA Change: M46V

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114092
Gene: ENSMUSG00000026592
AA Change: M46V

DomainStartEndE-ValueType
Pfam:Tsc35 1 201 5.4e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119526
AA Change: M25V

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113325
Gene: ENSMUSG00000026592
AA Change: M25V

DomainStartEndE-ValueType
Pfam:DUF4546 1 180 6.6e-104 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121911
AA Change: M25V

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113622
Gene: ENSMUSG00000026592
AA Change: M25V

DomainStartEndE-ValueType
Pfam:DUF4546 1 181 2e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148649
SMART Domains Protein: ENSMUSP00000116924
Gene: ENSMUSG00000026592

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187546
AA Change: M46V

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139460
Gene: ENSMUSG00000026592
AA Change: M46V

DomainStartEndE-ValueType
Pfam:DUF4546 1 183 3e-98 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrp T C 8: 105,567,368 E41G probably benign Het
Amph A T 13: 19,046,016 N45Y probably damaging Het
Atp11a T A 8: 12,832,522 L470Q probably damaging Het
C130073F10Rik T A 4: 101,890,749 Y76F possibly damaging Het
Casp12 A T 9: 5,354,548 I306F probably benign Het
Cobll1 A T 2: 65,103,268 M460K probably benign Het
Col6a4 A T 9: 106,013,696 L1800I possibly damaging Het
Ctdsp1 T C 1: 74,394,068 V131A probably damaging Het
Ctnna3 A G 10: 64,675,885 H618R probably benign Het
Dhx38 C A 8: 109,556,902 V538L possibly damaging Het
Dtwd1 A G 2: 126,159,813 D151G probably damaging Het
Fbxw28 A G 9: 109,338,536 L51P probably damaging Het
Gm4781 C T 10: 100,396,969 noncoding transcript Het
Gm5134 C A 10: 76,004,760 F479L probably benign Het
Hexa T G 9: 59,560,960 V290G probably damaging Het
Hist3h2ba A G 11: 58,949,009 K24E probably benign Het
Ifi206 C T 1: 173,481,362 R356K possibly damaging Het
Kcnj12 G A 11: 61,070,451 R525Q possibly damaging Het
Lrp2 A T 2: 69,455,525 I3774N probably damaging Het
Msh4 C A 3: 153,863,439 M832I probably benign Het
Myh10 A G 11: 68,785,859 E852G probably damaging Het
Ndufaf1 A T 2: 119,660,482 C32* probably null Het
Nos2 A G 11: 78,940,152 E387G probably null Het
Olfr1062 A G 2: 86,423,325 V117A probably benign Het
Olfr1311 C T 2: 112,021,531 G108R probably damaging Het
Olfr1352 A C 10: 78,984,678 D296A possibly damaging Het
Olfr197 T A 16: 59,185,903 L193F unknown Het
Olfr545 A G 7: 102,493,971 V268A probably benign Het
Olfr847 A T 9: 19,375,718 H54Q probably benign Het
P3h3 T C 6: 124,855,958 T211A probably benign Het
Pcdh7 A G 5: 57,719,514 N137S probably damaging Het
Pgf T C 12: 85,169,374 T157A possibly damaging Het
Prex1 T C 2: 166,586,659 D714G probably damaging Het
Scn7a T C 2: 66,692,569 I930M probably damaging Het
Siglecg T C 7: 43,409,413 S197P possibly damaging Het
Skint7 T A 4: 111,988,092 I367N probably benign Het
Slfn5 A T 11: 82,961,004 D652V probably damaging Het
Stx1b G A 7: 127,810,918 Q3* probably null Het
Tkt A C 14: 30,558,776 T55P possibly damaging Het
Trim30c T C 7: 104,383,331 R263G probably benign Het
U2af2 G A 7: 5,066,451 R33Q probably benign Het
Washc4 T A 10: 83,555,605 V182D probably damaging Het
Xirp2 T C 2: 67,510,004 V863A possibly damaging Het
Zfp976 T G 7: 42,614,080 H111P probably benign Het
Zfp982 A T 4: 147,510,864 N48Y probably damaging Het
Other mutations in Tex35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Tex35 APN 1 157099756 intron probably benign
IGL01063:Tex35 APN 1 157105097 splice site probably benign
R0006:Tex35 UTSW 1 157099744 missense possibly damaging 0.95
R0006:Tex35 UTSW 1 157099744 missense possibly damaging 0.95
R4595:Tex35 UTSW 1 157099339 missense probably benign 0.23
R4855:Tex35 UTSW 1 157099725 missense probably damaging 0.99
R5636:Tex35 UTSW 1 157100224 nonsense probably null
R7426:Tex35 UTSW 1 157105086 missense probably damaging 0.99
R7868:Tex35 UTSW 1 157099338 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTATCCAGCAAGGGGAAG -3'
(R):5'- GCCACCAGCTTGTCTTTGTG -3'

Sequencing Primer
(F):5'- GCCATTCTTTGCAAACTGGAG -3'
(R):5'- TGTCCTGCCTTCAGAGAGG -3'
Posted On2016-12-15