Incidental Mutation 'R5777:Ifi206'
ID446737
Institutional Source Beutler Lab
Gene Symbol Ifi206
Ensembl Gene ENSMUSG00000037849
Gene Nameinterferon activated gene 206
SynonymsGm4955, Pyblhin-C
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R5777 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location173468485-173491041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 173481362 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 356 (R356K)
Ref Sequence ENSEMBL: ENSMUSP00000134646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160565]
Predicted Effect possibly damaging
Transcript: ENSMUST00000160565
AA Change: R356K

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134646
Gene: ENSMUSG00000037849
AA Change: R356K

DomainStartEndE-ValueType
PYRIN 6 84 5.7e-21 SMART
low complexity region 97 108 N/A INTRINSIC
internal_repeat_1 154 349 6.25e-15 PROSPERO
internal_repeat_1 342 575 6.25e-15 PROSPERO
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrp T C 8: 105,567,368 E41G probably benign Het
Amph A T 13: 19,046,016 N45Y probably damaging Het
Atp11a T A 8: 12,832,522 L470Q probably damaging Het
C130073F10Rik T A 4: 101,890,749 Y76F possibly damaging Het
Casp12 A T 9: 5,354,548 I306F probably benign Het
Cobll1 A T 2: 65,103,268 M460K probably benign Het
Col6a4 A T 9: 106,013,696 L1800I possibly damaging Het
Ctdsp1 T C 1: 74,394,068 V131A probably damaging Het
Ctnna3 A G 10: 64,675,885 H618R probably benign Het
Dhx38 C A 8: 109,556,902 V538L possibly damaging Het
Dtwd1 A G 2: 126,159,813 D151G probably damaging Het
Fbxw28 A G 9: 109,338,536 L51P probably damaging Het
Gm4781 C T 10: 100,396,969 noncoding transcript Het
Gm5134 C A 10: 76,004,760 F479L probably benign Het
Hexa T G 9: 59,560,960 V290G probably damaging Het
Hist3h2ba A G 11: 58,949,009 K24E probably benign Het
Kcnj12 G A 11: 61,070,451 R525Q possibly damaging Het
Lrp2 A T 2: 69,455,525 I3774N probably damaging Het
Msh4 C A 3: 153,863,439 M832I probably benign Het
Myh10 A G 11: 68,785,859 E852G probably damaging Het
Ndufaf1 A T 2: 119,660,482 C32* probably null Het
Nos2 A G 11: 78,940,152 E387G probably null Het
Olfr1062 A G 2: 86,423,325 V117A probably benign Het
Olfr1311 C T 2: 112,021,531 G108R probably damaging Het
Olfr1352 A C 10: 78,984,678 D296A possibly damaging Het
Olfr197 T A 16: 59,185,903 L193F unknown Het
Olfr545 A G 7: 102,493,971 V268A probably benign Het
Olfr847 A T 9: 19,375,718 H54Q probably benign Het
P3h3 T C 6: 124,855,958 T211A probably benign Het
Pcdh7 A G 5: 57,719,514 N137S probably damaging Het
Pgf T C 12: 85,169,374 T157A possibly damaging Het
Prex1 T C 2: 166,586,659 D714G probably damaging Het
Scn7a T C 2: 66,692,569 I930M probably damaging Het
Siglecg T C 7: 43,409,413 S197P possibly damaging Het
Skint7 T A 4: 111,988,092 I367N probably benign Het
Slfn5 A T 11: 82,961,004 D652V probably damaging Het
Stx1b G A 7: 127,810,918 Q3* probably null Het
Tex35 T C 1: 157,107,207 M46V probably benign Het
Tkt A C 14: 30,558,776 T55P possibly damaging Het
Trim30c T C 7: 104,383,331 R263G probably benign Het
U2af2 G A 7: 5,066,451 R33Q probably benign Het
Washc4 T A 10: 83,555,605 V182D probably damaging Het
Xirp2 T C 2: 67,510,004 V863A possibly damaging Het
Zfp976 T G 7: 42,614,080 H111P probably benign Het
Zfp982 A T 4: 147,510,864 N48Y probably damaging Het
Other mutations in Ifi206
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01509:Ifi206 APN 1 173485576 missense probably benign 0.00
IGL02044:Ifi206 APN 1 173480991 missense probably benign 0.41
IGL02118:Ifi206 APN 1 173481768 missense probably benign 0.05
IGL02476:Ifi206 APN 1 173481566 missense probably benign 0.02
IGL02824:Ifi206 APN 1 173481872 missense possibly damaging 0.95
IGL03375:Ifi206 APN 1 173480778 missense probably benign 0.06
PIT4142001:Ifi206 UTSW 1 173481164 missense probably benign 0.02
R0069:Ifi206 UTSW 1 173486847 missense probably damaging 1.00
R0741:Ifi206 UTSW 1 173473749 missense probably benign 0.41
R1572:Ifi206 UTSW 1 173486853 missense probably benign 0.10
R1742:Ifi206 UTSW 1 173481971 missense probably benign 0.06
R4109:Ifi206 UTSW 1 173480988 missense probably benign 0.00
R4707:Ifi206 UTSW 1 173480866 missense probably benign 0.00
R4783:Ifi206 UTSW 1 173480866 missense probably benign 0.00
R4785:Ifi206 UTSW 1 173480866 missense probably benign 0.00
R4805:Ifi206 UTSW 1 173481386 missense possibly damaging 0.55
R4918:Ifi206 UTSW 1 173482044 missense possibly damaging 0.73
R5043:Ifi206 UTSW 1 173486718 missense probably damaging 1.00
R5080:Ifi206 UTSW 1 173473848 missense possibly damaging 0.61
R5419:Ifi206 UTSW 1 173481231 missense probably benign 0.05
R5420:Ifi206 UTSW 1 173481033 missense possibly damaging 0.84
R5988:Ifi206 UTSW 1 173481340 missense possibly damaging 0.90
R6772:Ifi206 UTSW 1 173481207 missense unknown
R6782:Ifi206 UTSW 1 173481357 missense unknown
R6806:Ifi206 UTSW 1 173481571 missense probably benign 0.06
R7042:Ifi206 UTSW 1 173481242 missense
R7091:Ifi206 UTSW 1 173473875 missense unknown
R7292:Ifi206 UTSW 1 173473862 missense unknown
R7429:Ifi206 UTSW 1 173480591 missense
R7499:Ifi206 UTSW 1 173482041 missense
R7772:Ifi206 UTSW 1 173481074 missense
R7853:Ifi206 UTSW 1 173471534 nonsense probably null
R8079:Ifi206 UTSW 1 173481158 missense
X0052:Ifi206 UTSW 1 173481969 missense possibly damaging 0.89
Z1088:Ifi206 UTSW 1 173474011 missense probably damaging 1.00
Z1176:Ifi206 UTSW 1 173482048 missense
Predicted Primers PCR Primer
(F):5'- TGCTGCAGACATCTGAGGAC -3'
(R):5'- ATTAAACCTCAGGTGACCCCAG -3'

Sequencing Primer
(F):5'- CTGCAGACATCTGAGGACTGTTAC -3'
(R):5'- CAATGTTACTCAGCGGTGTCCAAG -3'
Posted On2016-12-15