Mutagenetix > Incidental Mutation

Incidental Mutation 'R5777:Ifi206'

446737

Institutional Source

Beutler Lab

Gene Symbol

Ifi206

Ensembl Gene

ENSMUSG00000037849

Gene Name

interferon activated gene 206

Synonyms

Gm4955, Pyblhin-C

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R5777 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

173468485-173491041 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 173481362 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Lysine at position 356 (R356K)

Ref Sequence

ENSEMBL: ENSMUSP00000134646 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160565]

AlphaFold

G3UZV2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160565
AA Change: R356K

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000134646
Gene: ENSMUSG00000037849
AA Change: R356K

Domain	Start	End	E-Value	Type
PYRIN	6	84	5.7e-21	SMART
low complexity region	97	108	N/A	INTRINSIC
internal_repeat_1	154	349	6.25e-15	PROSPERO
internal_repeat_1	342	575	6.25e-15	PROSPERO

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agrp	T	C	8: 105,567,368	E41G	probably benign	Het
Amph	A	T	13: 19,046,016	N45Y	probably damaging	Het
Atp11a	T	A	8: 12,832,522	L470Q	probably damaging	Het
C130073F10Rik	T	A	4: 101,890,749	Y76F	possibly damaging	Het
Casp12	A	T	9: 5,354,548	I306F	probably benign	Het
Cobll1	A	T	2: 65,103,268	M460K	probably benign	Het
Col6a4	A	T	9: 106,013,696	L1800I	possibly damaging	Het
Ctdsp1	T	C	1: 74,394,068	V131A	probably damaging	Het
Ctnna3	A	G	10: 64,675,885	H618R	probably benign	Het
Dhx38	C	A	8: 109,556,902	V538L	possibly damaging	Het
Dtwd1	A	G	2: 126,159,813	D151G	probably damaging	Het
Fbxw28	A	G	9: 109,338,536	L51P	probably damaging	Het
Gm4781	C	T	10: 100,396,969		noncoding transcript	Het
Gm5134	C	A	10: 76,004,760	F479L	probably benign	Het
Hexa	T	G	9: 59,560,960	V290G	probably damaging	Het
Hist3h2ba	A	G	11: 58,949,009	K24E	probably benign	Het
Kcnj12	G	A	11: 61,070,451	R525Q	possibly damaging	Het
Lrp2	A	T	2: 69,455,525	I3774N	probably damaging	Het
Msh4	C	A	3: 153,863,439	M832I	probably benign	Het
Myh10	A	G	11: 68,785,859	E852G	probably damaging	Het
Ndufaf1	A	T	2: 119,660,482	C32*	probably null	Het
Nos2	A	G	11: 78,940,152	E387G	probably null	Het
Olfr1062	A	G	2: 86,423,325	V117A	probably benign	Het
Olfr1311	C	T	2: 112,021,531	G108R	probably damaging	Het
Olfr1352	A	C	10: 78,984,678	D296A	possibly damaging	Het
Olfr197	T	A	16: 59,185,903	L193F	unknown	Het
Olfr545	A	G	7: 102,493,971	V268A	probably benign	Het
Olfr847	A	T	9: 19,375,718	H54Q	probably benign	Het
P3h3	T	C	6: 124,855,958	T211A	probably benign	Het
Pcdh7	A	G	5: 57,719,514	N137S	probably damaging	Het
Pgf	T	C	12: 85,169,374	T157A	possibly damaging	Het
Prex1	T	C	2: 166,586,659	D714G	probably damaging	Het
Scn7a	T	C	2: 66,692,569	I930M	probably damaging	Het
Siglecg	T	C	7: 43,409,413	S197P	possibly damaging	Het
Skint7	T	A	4: 111,988,092	I367N	probably benign	Het
Slfn5	A	T	11: 82,961,004	D652V	probably damaging	Het
Stx1b	G	A	7: 127,810,918	Q3*	probably null	Het
Tex35	T	C	1: 157,107,207	M46V	probably benign	Het
Tkt	A	C	14: 30,558,776	T55P	possibly damaging	Het
Trim30c	T	C	7: 104,383,331	R263G	probably benign	Het
U2af2	G	A	7: 5,066,451	R33Q	probably benign	Het
Washc4	T	A	10: 83,555,605	V182D	probably damaging	Het
Xirp2	T	C	2: 67,510,004	V863A	possibly damaging	Het
Zfp976	T	G	7: 42,614,080	H111P	probably benign	Het
Zfp982	A	T	4: 147,510,864	N48Y	probably damaging	Het

Other mutations in Ifi206

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01509:Ifi206	APN	1	173485576	missense	probably benign	0.00
IGL02044:Ifi206	APN	1	173480991	missense	probably benign	0.41
IGL02118:Ifi206	APN	1	173481768	missense	probably benign	0.05
IGL02476:Ifi206	APN	1	173481566	missense	probably benign	0.02
IGL02824:Ifi206	APN	1	173481872	missense	possibly damaging	0.95
IGL03375:Ifi206	APN	1	173480778	missense	probably benign	0.06
PIT4142001:Ifi206	UTSW	1	173481164	missense	probably benign	0.02
R0069:Ifi206	UTSW	1	173486847	missense	probably damaging	1.00
R0741:Ifi206	UTSW	1	173473749	missense	probably benign	0.41
R1572:Ifi206	UTSW	1	173486853	missense	probably benign	0.10
R1742:Ifi206	UTSW	1	173481971	missense	probably benign	0.06
R4109:Ifi206	UTSW	1	173480988	missense	probably benign	0.00
R4707:Ifi206	UTSW	1	173480866	missense	probably benign	0.00
R4783:Ifi206	UTSW	1	173480866	missense	probably benign	0.00
R4785:Ifi206	UTSW	1	173480866	missense	probably benign	0.00
R4805:Ifi206	UTSW	1	173481386	missense	possibly damaging	0.55
R4918:Ifi206	UTSW	1	173482044	missense	possibly damaging	0.73
R5043:Ifi206	UTSW	1	173486718	missense	probably damaging	1.00
R5080:Ifi206	UTSW	1	173473848	missense	possibly damaging	0.61
R5419:Ifi206	UTSW	1	173481231	missense	probably benign	0.05
R5420:Ifi206	UTSW	1	173481033	missense	possibly damaging	0.84
R5988:Ifi206	UTSW	1	173481340	missense	possibly damaging	0.90
R6772:Ifi206	UTSW	1	173481207	missense	unknown
R6782:Ifi206	UTSW	1	173481357	missense	unknown
R6806:Ifi206	UTSW	1	173481571	missense	probably benign	0.06
R7042:Ifi206	UTSW	1	173481242	missense
R7091:Ifi206	UTSW	1	173473875	missense	unknown
R7292:Ifi206	UTSW	1	173473862	missense	unknown
R7429:Ifi206	UTSW	1	173480591	missense
R7499:Ifi206	UTSW	1	173482041	missense
R7772:Ifi206	UTSW	1	173481074	missense
R7853:Ifi206	UTSW	1	173471534	nonsense	probably null
R7971:Ifi206	UTSW	1	173471410	missense	unknown
R8079:Ifi206	UTSW	1	173481158	missense
R8390:Ifi206	UTSW	1	173480945	missense
R8500:Ifi206	UTSW	1	173486745	missense
R8712:Ifi206	UTSW	1	173480508	missense
R8753:Ifi206	UTSW	1	173473657	missense	unknown
R8875:Ifi206	UTSW	1	173473787	missense	unknown
R9128:Ifi206	UTSW	1	173471456	missense	unknown
R9369:Ifi206	UTSW	1	173473923	missense	unknown
R9569:Ifi206	UTSW	1	173486643	missense
R9676:Ifi206	UTSW	1	173481152	missense
R9695:Ifi206	UTSW	1	173473683	missense	unknown
R9776:Ifi206	UTSW	1	173480509	missense
X0052:Ifi206	UTSW	1	173481969	missense	possibly damaging	0.89
Z1088:Ifi206	UTSW	1	173474011	missense	probably damaging	1.00
Z1176:Ifi206	UTSW	1	173482048	missense

Predicted Primers

PCR Primer
(F):5'- TGCTGCAGACATCTGAGGAC -3'
(R):5'- ATTAAACCTCAGGTGACCCCAG -3'

Sequencing Primer
(F):5'- CTGCAGACATCTGAGGACTGTTAC -3'
(R):5'- CAATGTTACTCAGCGGTGTCCAAG -3'

Posted On

2016-12-15