Incidental Mutation 'R5777:Ndufaf1'
ID446745
Institutional Source Beutler Lab
Gene Symbol Ndufaf1
Ensembl Gene ENSMUSG00000027305
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1
SynonymsCGI-65, 2410001M24Rik, CIA30
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R5777 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119655446-119662827 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 119660482 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 32 (C32*)
Ref Sequence ENSEMBL: ENSMUSP00000106426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028768] [ENSMUST00000110801] [ENSMUST00000110802]
Predicted Effect probably null
Transcript: ENSMUST00000028768
AA Change: C34*
SMART Domains Protein: ENSMUSP00000028768
Gene: ENSMUSG00000027305
AA Change: C34*

DomainStartEndE-ValueType
Pfam:CIA30 128 301 3e-51 PFAM
Pfam:CBM_11 193 315 1.7e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110801
AA Change: C32*
SMART Domains Protein: ENSMUSP00000106425
Gene: ENSMUSG00000027305
AA Change: C32*

DomainStartEndE-ValueType
Pfam:CIA30 126 299 1.1e-47 PFAM
Pfam:CBM_11 127 312 1.3e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110802
AA Change: C32*
SMART Domains Protein: ENSMUSP00000106426
Gene: ENSMUSG00000027305
AA Change: C32*

DomainStartEndE-ValueType
Pfam:CIA30 126 299 1.1e-47 PFAM
Pfam:CBM_11 127 312 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154127
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a complex I assembly factor protein. Complex I (NADH-ubiquinone oxidoreductase) catalyzes the transfer of electrons from NADH to ubiquinone (coenzyme Q) in the first step of the mitochondrial respiratory chain, resulting in the translocation of protons across the inner mitochondrial membrane. The encoded protein is required for assembly of complex I, and mutations in this gene are a cause of mitochondrial complex I deficiency. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrp T C 8: 105,567,368 E41G probably benign Het
Amph A T 13: 19,046,016 N45Y probably damaging Het
Atp11a T A 8: 12,832,522 L470Q probably damaging Het
C130073F10Rik T A 4: 101,890,749 Y76F possibly damaging Het
Casp12 A T 9: 5,354,548 I306F probably benign Het
Cobll1 A T 2: 65,103,268 M460K probably benign Het
Col6a4 A T 9: 106,013,696 L1800I possibly damaging Het
Ctdsp1 T C 1: 74,394,068 V131A probably damaging Het
Ctnna3 A G 10: 64,675,885 H618R probably benign Het
Dhx38 C A 8: 109,556,902 V538L possibly damaging Het
Dtwd1 A G 2: 126,159,813 D151G probably damaging Het
Fbxw28 A G 9: 109,338,536 L51P probably damaging Het
Gm4781 C T 10: 100,396,969 noncoding transcript Het
Gm5134 C A 10: 76,004,760 F479L probably benign Het
Hexa T G 9: 59,560,960 V290G probably damaging Het
Hist3h2ba A G 11: 58,949,009 K24E probably benign Het
Ifi206 C T 1: 173,481,362 R356K possibly damaging Het
Kcnj12 G A 11: 61,070,451 R525Q possibly damaging Het
Lrp2 A T 2: 69,455,525 I3774N probably damaging Het
Msh4 C A 3: 153,863,439 M832I probably benign Het
Myh10 A G 11: 68,785,859 E852G probably damaging Het
Nos2 A G 11: 78,940,152 E387G probably null Het
Olfr1062 A G 2: 86,423,325 V117A probably benign Het
Olfr1311 C T 2: 112,021,531 G108R probably damaging Het
Olfr1352 A C 10: 78,984,678 D296A possibly damaging Het
Olfr197 T A 16: 59,185,903 L193F unknown Het
Olfr545 A G 7: 102,493,971 V268A probably benign Het
Olfr847 A T 9: 19,375,718 H54Q probably benign Het
P3h3 T C 6: 124,855,958 T211A probably benign Het
Pcdh7 A G 5: 57,719,514 N137S probably damaging Het
Pgf T C 12: 85,169,374 T157A possibly damaging Het
Prex1 T C 2: 166,586,659 D714G probably damaging Het
Scn7a T C 2: 66,692,569 I930M probably damaging Het
Siglecg T C 7: 43,409,413 S197P possibly damaging Het
Skint7 T A 4: 111,988,092 I367N probably benign Het
Slfn5 A T 11: 82,961,004 D652V probably damaging Het
Stx1b G A 7: 127,810,918 Q3* probably null Het
Tex35 T C 1: 157,107,207 M46V probably benign Het
Tkt A C 14: 30,558,776 T55P possibly damaging Het
Trim30c T C 7: 104,383,331 R263G probably benign Het
U2af2 G A 7: 5,066,451 R33Q probably benign Het
Washc4 T A 10: 83,555,605 V182D probably damaging Het
Xirp2 T C 2: 67,510,004 V863A possibly damaging Het
Zfp976 T G 7: 42,614,080 H111P probably benign Het
Zfp982 A T 4: 147,510,864 N48Y probably damaging Het
Other mutations in Ndufaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Ndufaf1 APN 2 119660469 missense probably damaging 1.00
IGL01871:Ndufaf1 APN 2 119658287 nonsense probably null
IGL02452:Ndufaf1 APN 2 119656426 missense probably damaging 1.00
IGL03087:Ndufaf1 APN 2 119655799 splice site probably benign
R1211:Ndufaf1 UTSW 2 119655675 missense probably damaging 1.00
R2420:Ndufaf1 UTSW 2 119655737 missense probably damaging 1.00
R2421:Ndufaf1 UTSW 2 119655737 missense probably damaging 1.00
R2422:Ndufaf1 UTSW 2 119655737 missense probably damaging 1.00
R3824:Ndufaf1 UTSW 2 119660271 missense probably benign 0.30
R4942:Ndufaf1 UTSW 2 119660066 missense possibly damaging 0.83
R5382:Ndufaf1 UTSW 2 119660412 missense possibly damaging 0.75
R5460:Ndufaf1 UTSW 2 119660477 missense probably benign 0.02
R5732:Ndufaf1 UTSW 2 119660040 nonsense probably null
R5919:Ndufaf1 UTSW 2 119660228 missense possibly damaging 0.51
R6371:Ndufaf1 UTSW 2 119660053 missense probably damaging 1.00
R6378:Ndufaf1 UTSW 2 119655726 missense probably damaging 0.99
R7202:Ndufaf1 UTSW 2 119658426 missense probably benign 0.39
R7224:Ndufaf1 UTSW 2 119658396 missense probably damaging 1.00
R7847:Ndufaf1 UTSW 2 119660053 missense probably damaging 1.00
R7930:Ndufaf1 UTSW 2 119660053 missense probably damaging 1.00
R8208:Ndufaf1 UTSW 2 119660346 missense probably benign 0.01
R8319:Ndufaf1 UTSW 2 119660087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGGCCTCTCAAATGAGC -3'
(R):5'- GCCACTGTTGAGTAAATTGGGG -3'

Sequencing Primer
(F):5'- GGCCTCTCAAATGAGCCACAATTTC -3'
(R):5'- ATTCATTGCTCTGCTGATAATTGG -3'
Posted On2016-12-15