Incidental Mutation 'R5777:P3h3'
ID446754
Institutional Source Beutler Lab
Gene Symbol P3h3
Ensembl Gene ENSMUSG00000023191
Gene Nameprolyl 3-hydroxylase 3
SynonymsGrcb, Leprel2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5777 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124841089-124857752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124855958 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 211 (T211A)
Ref Sequence ENSEMBL: ENSMUSP00000116338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023958] [ENSMUST00000046893] [ENSMUST00000135127] [ENSMUST00000204667]
Predicted Effect probably benign
Transcript: ENSMUST00000023958
AA Change: T211A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000023958
Gene: ENSMUSG00000023191
AA Change: T211A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
P4Hc 460 670 8.51e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046893
SMART Domains Protein: ENSMUSP00000038536
Gene: ENSMUSG00000038390

DomainStartEndE-ValueType
Pfam:7tm_1 30 337 1.1e-19 PFAM
low complexity region 348 362 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 482 504 N/A INTRINSIC
low complexity region 513 540 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129225
Predicted Effect probably benign
Transcript: ENSMUST00000135127
AA Change: T211A

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116338
Gene: ENSMUSG00000023191
AA Change: T211A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204161
Predicted Effect probably benign
Transcript: ENSMUST00000204667
SMART Domains Protein: ENSMUSP00000145267
Gene: ENSMUSG00000038390

DomainStartEndE-ValueType
Pfam:7tm_1 30 337 1.1e-19 PFAM
low complexity region 348 362 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 482 504 N/A INTRINSIC
low complexity region 513 540 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the leprecan family of proteoglycans, which function as collagen prolyl hydroxylases that are required for proper collagen biosynthesis, folding and assembly. This protein, like other family members, is thought to reside in the endoplasmic reticulum. Epigenetic inactivation of this gene is associated with breast and other cancers, suggesting that it may function as a tumor suppressor. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit collagen fiber fragility in the skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrp T C 8: 105,567,368 E41G probably benign Het
Amph A T 13: 19,046,016 N45Y probably damaging Het
Atp11a T A 8: 12,832,522 L470Q probably damaging Het
C130073F10Rik T A 4: 101,890,749 Y76F possibly damaging Het
Casp12 A T 9: 5,354,548 I306F probably benign Het
Cobll1 A T 2: 65,103,268 M460K probably benign Het
Col6a4 A T 9: 106,013,696 L1800I possibly damaging Het
Ctdsp1 T C 1: 74,394,068 V131A probably damaging Het
Ctnna3 A G 10: 64,675,885 H618R probably benign Het
Dhx38 C A 8: 109,556,902 V538L possibly damaging Het
Dtwd1 A G 2: 126,159,813 D151G probably damaging Het
Fbxw28 A G 9: 109,338,536 L51P probably damaging Het
Gm4781 C T 10: 100,396,969 noncoding transcript Het
Gm5134 C A 10: 76,004,760 F479L probably benign Het
Hexa T G 9: 59,560,960 V290G probably damaging Het
Hist3h2ba A G 11: 58,949,009 K24E probably benign Het
Ifi206 C T 1: 173,481,362 R356K possibly damaging Het
Kcnj12 G A 11: 61,070,451 R525Q possibly damaging Het
Lrp2 A T 2: 69,455,525 I3774N probably damaging Het
Msh4 C A 3: 153,863,439 M832I probably benign Het
Myh10 A G 11: 68,785,859 E852G probably damaging Het
Ndufaf1 A T 2: 119,660,482 C32* probably null Het
Nos2 A G 11: 78,940,152 E387G probably null Het
Olfr1062 A G 2: 86,423,325 V117A probably benign Het
Olfr1311 C T 2: 112,021,531 G108R probably damaging Het
Olfr1352 A C 10: 78,984,678 D296A possibly damaging Het
Olfr197 T A 16: 59,185,903 L193F unknown Het
Olfr545 A G 7: 102,493,971 V268A probably benign Het
Olfr847 A T 9: 19,375,718 H54Q probably benign Het
Pcdh7 A G 5: 57,719,514 N137S probably damaging Het
Pgf T C 12: 85,169,374 T157A possibly damaging Het
Prex1 T C 2: 166,586,659 D714G probably damaging Het
Scn7a T C 2: 66,692,569 I930M probably damaging Het
Siglecg T C 7: 43,409,413 S197P possibly damaging Het
Skint7 T A 4: 111,988,092 I367N probably benign Het
Slfn5 A T 11: 82,961,004 D652V probably damaging Het
Stx1b G A 7: 127,810,918 Q3* probably null Het
Tex35 T C 1: 157,107,207 M46V probably benign Het
Tkt A C 14: 30,558,776 T55P possibly damaging Het
Trim30c T C 7: 104,383,331 R263G probably benign Het
U2af2 G A 7: 5,066,451 R33Q probably benign Het
Washc4 T A 10: 83,555,605 V182D probably damaging Het
Xirp2 T C 2: 67,510,004 V863A possibly damaging Het
Zfp976 T G 7: 42,614,080 H111P probably benign Het
Zfp982 A T 4: 147,510,864 N48Y probably damaging Het
Other mutations in P3h3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:P3h3 APN 6 124845589 missense probably benign 0.26
IGL02158:P3h3 APN 6 124853092 missense probably damaging 1.00
IGL02654:P3h3 APN 6 124845265 missense possibly damaging 0.95
P0040:P3h3 UTSW 6 124853136 missense probably damaging 0.99
R0024:P3h3 UTSW 6 124857458 missense probably benign
R0196:P3h3 UTSW 6 124845272 missense probably damaging 1.00
R0328:P3h3 UTSW 6 124854306 unclassified probably benign
R0589:P3h3 UTSW 6 124841681 missense probably damaging 1.00
R0605:P3h3 UTSW 6 124856035 missense probably damaging 1.00
R0793:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0794:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0795:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0796:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0853:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0854:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0856:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0893:P3h3 UTSW 6 124845513 missense probably damaging 1.00
R1819:P3h3 UTSW 6 124854932 missense probably benign 0.05
R2100:P3h3 UTSW 6 124845042 missense probably damaging 1.00
R4332:P3h3 UTSW 6 124842136 missense probably damaging 1.00
R4461:P3h3 UTSW 6 124845568 missense probably benign 0.08
R4533:P3h3 UTSW 6 124854408 missense possibly damaging 0.62
R4829:P3h3 UTSW 6 124841638 utr 3 prime probably benign
R4840:P3h3 UTSW 6 124850637 missense possibly damaging 0.82
R4962:P3h3 UTSW 6 124841773 missense probably benign 0.09
R5014:P3h3 UTSW 6 124855236 missense probably damaging 1.00
R5591:P3h3 UTSW 6 124854695 unclassified probably benign
R5691:P3h3 UTSW 6 124855153 missense probably damaging 1.00
R5846:P3h3 UTSW 6 124857194 critical splice donor site probably null
R6212:P3h3 UTSW 6 124845643 missense probably benign 0.19
R6254:P3h3 UTSW 6 124845601 missense probably damaging 1.00
R6320:P3h3 UTSW 6 124854872 missense probably benign 0.02
R6860:P3h3 UTSW 6 124857368 missense probably benign 0.01
R7385:P3h3 UTSW 6 124855270 missense probably damaging 1.00
R7472:P3h3 UTSW 6 124850631 missense possibly damaging 0.92
R7617:P3h3 UTSW 6 124856006 missense probably damaging 1.00
R7763:P3h3 UTSW 6 124854432 missense probably benign 0.00
R7831:P3h3 UTSW 6 124855155 missense possibly damaging 0.86
R7914:P3h3 UTSW 6 124855155 missense possibly damaging 0.86
R8317:P3h3 UTSW 6 124855153 missense probably damaging 1.00
X0021:P3h3 UTSW 6 124856029 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAACGCTAGAACGGCAC -3'
(R):5'- CCAGTTTTGATTGGCTAGGC -3'

Sequencing Primer
(F):5'- CGCTAGAACGGCACACTTTAG -3'
(R):5'- CCATAAGGCTCTGGGGGAG -3'
Posted On2016-12-15