Incidental Mutation 'R5777:U2af2'
ID446755
Institutional Source Beutler Lab
Gene Symbol U2af2
Ensembl Gene ENSMUSG00000030435
Gene NameU2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5777 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location5062143-5079938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5066451 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 33 (R33Q)
Ref Sequence ENSEMBL: ENSMUSP00000147013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005041] [ENSMUST00000165399] [ENSMUST00000207097] [ENSMUST00000209099]
Predicted Effect probably benign
Transcript: ENSMUST00000005041
AA Change: R33Q

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000005041
Gene: ENSMUSG00000030435
AA Change: R33Q

DomainStartEndE-ValueType
low complexity region 23 62 N/A INTRINSIC
PDB:1JMT|B 85 112 9e-13 PDB
RRM 150 227 1.26e-11 SMART
low complexity region 242 257 N/A INTRINSIC
RRM 260 333 8.64e-19 SMART
RRM 377 462 3.04e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165399
SMART Domains Protein: ENSMUSP00000131458
Gene: ENSMUSG00000030435

DomainStartEndE-ValueType
RRM 8 63 3.31e0 SMART
low complexity region 78 93 N/A INTRINSIC
RRM 96 169 8.64e-19 SMART
RRM 209 294 3.04e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000207097
AA Change: R33Q
Predicted Effect probably benign
Transcript: ENSMUST00000207498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208419
Predicted Effect probably benign
Transcript: ENSMUST00000209099
AA Change: R33Q

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] U2 auxiliary factor (U2AF), comprised of a large and a small subunit, is a non-snRNP protein required for the binding of U2 snRNP to the pre-mRNA branch site. This gene encodes the U2AF large subunit which contains a sequence-specific RNA-binding region with 3 RNA recognition motifs and an Arg/Ser-rich domain necessary for splicing. The large subunit binds to the polypyrimidine tract of introns early during spliceosome assembly. Multiple transcript variants have been detected for this gene, but the full-length natures of only two have been determined to date. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrp T C 8: 105,567,368 E41G probably benign Het
Amph A T 13: 19,046,016 N45Y probably damaging Het
Atp11a T A 8: 12,832,522 L470Q probably damaging Het
C130073F10Rik T A 4: 101,890,749 Y76F possibly damaging Het
Casp12 A T 9: 5,354,548 I306F probably benign Het
Cobll1 A T 2: 65,103,268 M460K probably benign Het
Col6a4 A T 9: 106,013,696 L1800I possibly damaging Het
Ctdsp1 T C 1: 74,394,068 V131A probably damaging Het
Ctnna3 A G 10: 64,675,885 H618R probably benign Het
Dhx38 C A 8: 109,556,902 V538L possibly damaging Het
Dtwd1 A G 2: 126,159,813 D151G probably damaging Het
Fbxw28 A G 9: 109,338,536 L51P probably damaging Het
Gm4781 C T 10: 100,396,969 noncoding transcript Het
Gm5134 C A 10: 76,004,760 F479L probably benign Het
Hexa T G 9: 59,560,960 V290G probably damaging Het
Hist3h2ba A G 11: 58,949,009 K24E probably benign Het
Ifi206 C T 1: 173,481,362 R356K possibly damaging Het
Kcnj12 G A 11: 61,070,451 R525Q possibly damaging Het
Lrp2 A T 2: 69,455,525 I3774N probably damaging Het
Msh4 C A 3: 153,863,439 M832I probably benign Het
Myh10 A G 11: 68,785,859 E852G probably damaging Het
Ndufaf1 A T 2: 119,660,482 C32* probably null Het
Nos2 A G 11: 78,940,152 E387G probably null Het
Olfr1062 A G 2: 86,423,325 V117A probably benign Het
Olfr1311 C T 2: 112,021,531 G108R probably damaging Het
Olfr1352 A C 10: 78,984,678 D296A possibly damaging Het
Olfr197 T A 16: 59,185,903 L193F unknown Het
Olfr545 A G 7: 102,493,971 V268A probably benign Het
Olfr847 A T 9: 19,375,718 H54Q probably benign Het
P3h3 T C 6: 124,855,958 T211A probably benign Het
Pcdh7 A G 5: 57,719,514 N137S probably damaging Het
Pgf T C 12: 85,169,374 T157A possibly damaging Het
Prex1 T C 2: 166,586,659 D714G probably damaging Het
Scn7a T C 2: 66,692,569 I930M probably damaging Het
Siglecg T C 7: 43,409,413 S197P possibly damaging Het
Skint7 T A 4: 111,988,092 I367N probably benign Het
Slfn5 A T 11: 82,961,004 D652V probably damaging Het
Stx1b G A 7: 127,810,918 Q3* probably null Het
Tex35 T C 1: 157,107,207 M46V probably benign Het
Tkt A C 14: 30,558,776 T55P possibly damaging Het
Trim30c T C 7: 104,383,331 R263G probably benign Het
Washc4 T A 10: 83,555,605 V182D probably damaging Het
Xirp2 T C 2: 67,510,004 V863A possibly damaging Het
Zfp976 T G 7: 42,614,080 H111P probably benign Het
Zfp982 A T 4: 147,510,864 N48Y probably damaging Het
Other mutations in U2af2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03368:U2af2 APN 7 5067264 splice site probably benign
IGL02980:U2af2 UTSW 7 5068043 missense probably benign 0.37
R0919:U2af2 UTSW 7 5069434 splice site probably benign
R1768:U2af2 UTSW 7 5067545 missense probably benign 0.00
R2228:U2af2 UTSW 7 5075673 missense probably damaging 1.00
R2697:U2af2 UTSW 7 5067546 missense probably benign 0.00
R3974:U2af2 UTSW 7 5069439 splice site probably null
R5916:U2af2 UTSW 7 5079180 critical splice acceptor site probably null
R6290:U2af2 UTSW 7 5075684 missense probably benign
R6860:U2af2 UTSW 7 5079274 missense possibly damaging 0.77
R7827:U2af2 UTSW 7 5074662 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTAAAATCCCTTCCCTTGGGG -3'
(R):5'- AGTCTCTGTCCCCAGGAACTAC -3'

Sequencing Primer
(F):5'- TCTTGGTATAGCCACCAG -3'
(R):5'- AGTCCTTTAGCACTGCCAGAG -3'
Posted On2016-12-15