Incidental Mutation 'R5777:Zfp976'
ID446757
Institutional Source Beutler Lab
Gene Symbol Zfp976
Ensembl Gene ENSMUSG00000074158
Gene Namezinc finger protein 976
Synonyms9830147E19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5777 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location42609526-42642588 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 42614080 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 111 (H111P)
Ref Sequence ENSEMBL: ENSMUSP00000141023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098503] [ENSMUST00000187616]
Predicted Effect probably benign
Transcript: ENSMUST00000098503
AA Change: H112P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000096105
Gene: ENSMUSG00000074158
AA Change: H112P

DomainStartEndE-ValueType
KRAB 4 66 1.73e-18 SMART
ZnF_C2H2 131 153 7.78e-3 SMART
ZnF_C2H2 159 181 1.67e-2 SMART
ZnF_C2H2 187 209 5.9e-3 SMART
ZnF_C2H2 215 237 1.38e-3 SMART
ZnF_C2H2 243 265 8.94e-3 SMART
ZnF_C2H2 271 293 2.24e-3 SMART
ZnF_C2H2 299 321 1.03e-2 SMART
ZnF_C2H2 327 349 1.58e-3 SMART
ZnF_C2H2 355 377 7.9e-4 SMART
ZnF_C2H2 383 405 5.9e-3 SMART
ZnF_C2H2 411 433 2.57e-3 SMART
ZnF_C2H2 439 461 3.16e-3 SMART
ZnF_C2H2 467 489 1.26e-2 SMART
ZnF_C2H2 495 517 8.34e-3 SMART
ZnF_C2H2 523 545 3.63e-3 SMART
ZnF_C2H2 551 573 4.79e-3 SMART
ZnF_C2H2 579 601 9.73e-4 SMART
ZnF_C2H2 607 629 3.63e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107994
Predicted Effect probably benign
Transcript: ENSMUST00000187616
AA Change: H111P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000141023
Gene: ENSMUSG00000074158
AA Change: H111P

DomainStartEndE-ValueType
KRAB 3 65 7.4e-21 SMART
ZnF_C2H2 130 152 3.2e-5 SMART
ZnF_C2H2 158 180 7.1e-5 SMART
ZnF_C2H2 186 208 2.4e-5 SMART
ZnF_C2H2 214 236 5.7e-6 SMART
ZnF_C2H2 242 264 3.8e-5 SMART
ZnF_C2H2 270 292 9.7e-6 SMART
ZnF_C2H2 298 320 4.2e-5 SMART
ZnF_C2H2 326 348 6.6e-6 SMART
ZnF_C2H2 354 376 3.3e-6 SMART
ZnF_C2H2 382 404 2.5e-5 SMART
ZnF_C2H2 410 432 1e-5 SMART
ZnF_C2H2 438 460 1.3e-5 SMART
ZnF_C2H2 466 488 5.2e-5 SMART
ZnF_C2H2 494 516 3.6e-5 SMART
ZnF_C2H2 522 544 1.6e-5 SMART
ZnF_C2H2 550 572 2e-5 SMART
ZnF_C2H2 578 600 4e-6 SMART
ZnF_C2H2 606 628 1.5e-5 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrp T C 8: 105,567,368 E41G probably benign Het
Amph A T 13: 19,046,016 N45Y probably damaging Het
Atp11a T A 8: 12,832,522 L470Q probably damaging Het
C130073F10Rik T A 4: 101,890,749 Y76F possibly damaging Het
Casp12 A T 9: 5,354,548 I306F probably benign Het
Cobll1 A T 2: 65,103,268 M460K probably benign Het
Col6a4 A T 9: 106,013,696 L1800I possibly damaging Het
Ctdsp1 T C 1: 74,394,068 V131A probably damaging Het
Ctnna3 A G 10: 64,675,885 H618R probably benign Het
Dhx38 C A 8: 109,556,902 V538L possibly damaging Het
Dtwd1 A G 2: 126,159,813 D151G probably damaging Het
Fbxw28 A G 9: 109,338,536 L51P probably damaging Het
Gm4781 C T 10: 100,396,969 noncoding transcript Het
Gm5134 C A 10: 76,004,760 F479L probably benign Het
Hexa T G 9: 59,560,960 V290G probably damaging Het
Hist3h2ba A G 11: 58,949,009 K24E probably benign Het
Ifi206 C T 1: 173,481,362 R356K possibly damaging Het
Kcnj12 G A 11: 61,070,451 R525Q possibly damaging Het
Lrp2 A T 2: 69,455,525 I3774N probably damaging Het
Msh4 C A 3: 153,863,439 M832I probably benign Het
Myh10 A G 11: 68,785,859 E852G probably damaging Het
Ndufaf1 A T 2: 119,660,482 C32* probably null Het
Nos2 A G 11: 78,940,152 E387G probably null Het
Olfr1062 A G 2: 86,423,325 V117A probably benign Het
Olfr1311 C T 2: 112,021,531 G108R probably damaging Het
Olfr1352 A C 10: 78,984,678 D296A possibly damaging Het
Olfr197 T A 16: 59,185,903 L193F unknown Het
Olfr545 A G 7: 102,493,971 V268A probably benign Het
Olfr847 A T 9: 19,375,718 H54Q probably benign Het
P3h3 T C 6: 124,855,958 T211A probably benign Het
Pcdh7 A G 5: 57,719,514 N137S probably damaging Het
Pgf T C 12: 85,169,374 T157A possibly damaging Het
Prex1 T C 2: 166,586,659 D714G probably damaging Het
Scn7a T C 2: 66,692,569 I930M probably damaging Het
Siglecg T C 7: 43,409,413 S197P possibly damaging Het
Skint7 T A 4: 111,988,092 I367N probably benign Het
Slfn5 A T 11: 82,961,004 D652V probably damaging Het
Stx1b G A 7: 127,810,918 Q3* probably null Het
Tex35 T C 1: 157,107,207 M46V probably benign Het
Tkt A C 14: 30,558,776 T55P possibly damaging Het
Trim30c T C 7: 104,383,331 R263G probably benign Het
U2af2 G A 7: 5,066,451 R33Q probably benign Het
Washc4 T A 10: 83,555,605 V182D probably damaging Het
Xirp2 T C 2: 67,510,004 V863A possibly damaging Het
Zfp982 A T 4: 147,510,864 N48Y probably damaging Het
Other mutations in Zfp976
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Zfp976 APN 7 42613685 missense unknown
IGL01102:Zfp976 APN 7 42613909 nonsense probably null
IGL01111:Zfp976 APN 7 42616287 missense probably damaging 0.99
IGL01628:Zfp976 APN 7 42612511 missense unknown
IGL02008:Zfp976 APN 7 42614232 splice site probably benign
IGL02548:Zfp976 APN 7 42612529 missense unknown
R0190:Zfp976 UTSW 7 42642524 start gained probably benign
R0685:Zfp976 UTSW 7 42613717 missense probably damaging 0.98
R1310:Zfp976 UTSW 7 42613186 missense probably damaging 1.00
R1353:Zfp976 UTSW 7 42616018 missense probably damaging 0.99
R1447:Zfp976 UTSW 7 42612599 missense possibly damaging 0.79
R1569:Zfp976 UTSW 7 42613382 missense probably damaging 1.00
R1702:Zfp976 UTSW 7 42616000 missense possibly damaging 0.86
R1829:Zfp976 UTSW 7 42616311 missense probably damaging 1.00
R1939:Zfp976 UTSW 7 42613681 missense unknown
R1978:Zfp976 UTSW 7 42613841 missense probably damaging 1.00
R1981:Zfp976 UTSW 7 42613622 missense probably damaging 0.99
R2160:Zfp976 UTSW 7 42613930 missense probably benign
R2192:Zfp976 UTSW 7 42613271 missense probably damaging 1.00
R3121:Zfp976 UTSW 7 42613514 missense probably damaging 1.00
R4210:Zfp976 UTSW 7 42616325 missense probably damaging 0.99
R4724:Zfp976 UTSW 7 42613033 missense possibly damaging 0.91
R4943:Zfp976 UTSW 7 42612422 unclassified probably benign
R5047:Zfp976 UTSW 7 42613419 nonsense probably null
R5071:Zfp976 UTSW 7 42612930 nonsense probably null
R5125:Zfp976 UTSW 7 42612501 unclassified probably null
R5178:Zfp976 UTSW 7 42612501 unclassified probably null
R5305:Zfp976 UTSW 7 42613478 missense probably benign 0.00
R6153:Zfp976 UTSW 7 42614186 missense probably damaging 0.99
R6694:Zfp976 UTSW 7 42614186 missense probably damaging 0.99
R7226:Zfp976 UTSW 7 42613260 nonsense probably null
R7479:Zfp976 UTSW 7 42613179 missense probably benign 0.01
R7561:Zfp976 UTSW 7 42616277 missense probably damaging 1.00
R8178:Zfp976 UTSW 7 42613535 missense probably benign 0.03
R8261:Zfp976 UTSW 7 42612701 missense unknown
Z1088:Zfp976 UTSW 7 42612760 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TGTAGGGTCTCACTCCAGTATGTA -3'
(R):5'- CCATCTCTCTAGTCCCGTGATAA -3'

Sequencing Primer
(F):5'- CTCCTTAGAGTAAAGGCTTTAGCAC -3'
(R):5'- TCTAGTCCCGTGATAAAGCCCTAAG -3'
Posted On2016-12-15