Incidental Mutation 'R5777:Siglecg'
ID 446758
Institutional Source Beutler Lab
Gene Symbol Siglecg
Ensembl Gene ENSMUSG00000030468
Gene Name sialic acid binding Ig-like lectin G
Synonyms A630096C01Rik, mSiglec-G
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R5777 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 43057623-43067773 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43058837 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 197 (S197P)
Ref Sequence ENSEMBL: ENSMUSP00000005592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005592]
AlphaFold Q80ZE3
Predicted Effect possibly damaging
Transcript: ENSMUST00000005592
AA Change: S197P

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000005592
Gene: ENSMUSG00000030468
AA Change: S197P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 27 139 5.21e-2 SMART
IG_like 148 232 8.97e0 SMART
IGc2 262 325 3.38e-10 SMART
IGc2 366 427 8.26e-5 SMART
low complexity region 473 480 N/A INTRINSIC
transmembrane domain 545 564 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154322
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrp T C 8: 106,294,000 (GRCm39) E41G probably benign Het
Amph A T 13: 19,230,186 (GRCm39) N45Y probably damaging Het
Atp11a T A 8: 12,882,522 (GRCm39) L470Q probably damaging Het
C130073F10Rik T A 4: 101,747,946 (GRCm39) Y76F possibly damaging Het
Casp12 A T 9: 5,354,548 (GRCm39) I306F probably benign Het
Cobll1 A T 2: 64,933,612 (GRCm39) M460K probably benign Het
Col6a4 A T 9: 105,890,895 (GRCm39) L1800I possibly damaging Het
Ctdsp1 T C 1: 74,433,227 (GRCm39) V131A probably damaging Het
Ctnna3 A G 10: 64,511,664 (GRCm39) H618R probably benign Het
Dhx38 C A 8: 110,283,534 (GRCm39) V538L possibly damaging Het
Dtwd1 A G 2: 126,001,733 (GRCm39) D151G probably damaging Het
Fbxw28 A G 9: 109,167,604 (GRCm39) L51P probably damaging Het
Gm4781 C T 10: 100,232,831 (GRCm39) noncoding transcript Het
Gm5134 C A 10: 75,840,594 (GRCm39) F479L probably benign Het
H2bc27 A G 11: 58,839,835 (GRCm39) K24E probably benign Het
Hexa T G 9: 59,468,243 (GRCm39) V290G probably damaging Het
Ifi206 C T 1: 173,308,928 (GRCm39) R356K possibly damaging Het
Kcnj12 G A 11: 60,961,277 (GRCm39) R525Q possibly damaging Het
Lrp2 A T 2: 69,285,869 (GRCm39) I3774N probably damaging Het
Msh4 C A 3: 153,569,076 (GRCm39) M832I probably benign Het
Myh10 A G 11: 68,676,685 (GRCm39) E852G probably damaging Het
Ndufaf1 A T 2: 119,490,963 (GRCm39) C32* probably null Het
Nos2 A G 11: 78,830,978 (GRCm39) E387G probably null Het
Or4f58 C T 2: 111,851,876 (GRCm39) G108R probably damaging Het
Or55b10 A G 7: 102,143,178 (GRCm39) V268A probably benign Het
Or5h27 T A 16: 59,006,266 (GRCm39) L193F unknown Het
Or7a36 A C 10: 78,820,512 (GRCm39) D296A possibly damaging Het
Or7g29 A T 9: 19,287,014 (GRCm39) H54Q probably benign Het
Or8j3c A G 2: 86,253,669 (GRCm39) V117A probably benign Het
P3h3 T C 6: 124,832,921 (GRCm39) T211A probably benign Het
Pcdh7 A G 5: 57,876,856 (GRCm39) N137S probably damaging Het
Pgf T C 12: 85,216,148 (GRCm39) T157A possibly damaging Het
Prex1 T C 2: 166,428,579 (GRCm39) D714G probably damaging Het
Scn7a T C 2: 66,522,913 (GRCm39) I930M probably damaging Het
Skint7 T A 4: 111,845,289 (GRCm39) I367N probably benign Het
Slfn5 A T 11: 82,851,830 (GRCm39) D652V probably damaging Het
Stx1b G A 7: 127,410,090 (GRCm39) Q3* probably null Het
Tex35 T C 1: 156,934,777 (GRCm39) M46V probably benign Het
Tkt A C 14: 30,280,733 (GRCm39) T55P possibly damaging Het
Trim30c T C 7: 104,032,538 (GRCm39) R263G probably benign Het
U2af2 G A 7: 5,069,450 (GRCm39) R33Q probably benign Het
Washc4 T A 10: 83,391,469 (GRCm39) V182D probably damaging Het
Xirp2 T C 2: 67,340,348 (GRCm39) V863A possibly damaging Het
Zfp976 T G 7: 42,263,504 (GRCm39) H111P probably benign Het
Zfp982 A T 4: 147,595,321 (GRCm39) N48Y probably damaging Het
Other mutations in Siglecg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00528:Siglecg APN 7 43,058,481 (GRCm39) missense possibly damaging 0.64
IGL00556:Siglecg APN 7 43,061,219 (GRCm39) missense probably benign 0.02
IGL01806:Siglecg APN 7 43,060,888 (GRCm39) splice site probably null
IGL01947:Siglecg APN 7 43,058,187 (GRCm39) missense probably benign 0.43
IGL02257:Siglecg APN 7 43,061,328 (GRCm39) missense probably benign 0.00
IGL02410:Siglecg APN 7 43,058,253 (GRCm39) missense probably damaging 0.99
IGL02454:Siglecg APN 7 43,058,319 (GRCm39) missense probably benign 0.00
Chamonix UTSW 7 43,058,846 (GRCm39) missense possibly damaging 0.91
Dollywood UTSW 7 43,060,523 (GRCm39) missense probably damaging 1.00
glowworm UTSW 7 43,058,003 (GRCm39) missense probably benign 0.04
Montblanc UTSW 7 43,060,810 (GRCm39) intron probably benign
Shenandoah UTSW 7 43,058,226 (GRCm39) missense probably damaging 0.99
shenandoah2 UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
Sherando UTSW 7 43,058,481 (GRCm39) missense possibly damaging 0.64
Smokies UTSW 7 43,058,703 (GRCm39) missense probably benign 0.02
IGL02988:Siglecg UTSW 7 43,067,476 (GRCm39) missense probably damaging 1.00
R0134:Siglecg UTSW 7 43,060,595 (GRCm39) missense probably damaging 1.00
R0225:Siglecg UTSW 7 43,060,595 (GRCm39) missense probably damaging 1.00
R0480:Siglecg UTSW 7 43,060,550 (GRCm39) missense probably benign 0.42
R1538:Siglecg UTSW 7 43,067,313 (GRCm39) missense possibly damaging 0.53
R1681:Siglecg UTSW 7 43,058,365 (GRCm39) missense probably benign 0.17
R2358:Siglecg UTSW 7 43,058,846 (GRCm39) missense possibly damaging 0.91
R4428:Siglecg UTSW 7 43,067,350 (GRCm39) missense possibly damaging 0.84
R4429:Siglecg UTSW 7 43,067,350 (GRCm39) missense possibly damaging 0.84
R4736:Siglecg UTSW 7 43,067,332 (GRCm39) missense probably benign 0.03
R4754:Siglecg UTSW 7 43,061,295 (GRCm39) intron probably benign
R5017:Siglecg UTSW 7 43,060,810 (GRCm39) intron probably benign
R5713:Siglecg UTSW 7 43,058,226 (GRCm39) missense probably damaging 0.99
R5892:Siglecg UTSW 7 43,061,628 (GRCm39) intron probably benign
R6153:Siglecg UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
R6154:Siglecg UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
R6331:Siglecg UTSW 7 43,058,178 (GRCm39) missense possibly damaging 0.83
R6562:Siglecg UTSW 7 43,058,481 (GRCm39) missense possibly damaging 0.64
R6749:Siglecg UTSW 7 43,058,403 (GRCm39) missense probably benign 0.00
R7066:Siglecg UTSW 7 43,061,166 (GRCm39) missense probably benign 0.40
R7884:Siglecg UTSW 7 43,058,703 (GRCm39) missense probably benign 0.02
R8275:Siglecg UTSW 7 43,061,892 (GRCm39) missense probably benign
R8554:Siglecg UTSW 7 43,058,320 (GRCm39) missense probably benign 0.01
R8846:Siglecg UTSW 7 43,061,942 (GRCm39) missense probably benign 0.02
R8873:Siglecg UTSW 7 43,067,448 (GRCm39) missense probably benign 0.00
R8887:Siglecg UTSW 7 43,058,008 (GRCm39) missense probably benign 0.18
R9012:Siglecg UTSW 7 43,060,523 (GRCm39) missense probably damaging 1.00
R9032:Siglecg UTSW 7 43,061,049 (GRCm39) missense probably benign 0.24
R9048:Siglecg UTSW 7 43,058,003 (GRCm39) missense probably benign 0.04
R9085:Siglecg UTSW 7 43,061,049 (GRCm39) missense probably benign 0.24
R9313:Siglecg UTSW 7 43,061,856 (GRCm39) missense probably benign 0.03
R9320:Siglecg UTSW 7 43,058,853 (GRCm39) missense probably benign 0.33
R9745:Siglecg UTSW 7 43,067,476 (GRCm39) missense probably damaging 0.98
RF006:Siglecg UTSW 7 43,058,288 (GRCm39) nonsense probably null
Z1177:Siglecg UTSW 7 43,061,446 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTACTTCTGGGAGGAGC -3'
(R):5'- AGCATGGAGTTGGGGAATTC -3'

Sequencing Primer
(F):5'- CGCTGGAGTCACAGGATTG -3'
(R):5'- GAGTTGGGGAATTCTCTACCTCC -3'
Posted On 2016-12-15