Mutagenetix > Incidental Mutations

Incidental Mutation 'R5777:Siglecg'

446758

Institutional Source

Beutler Lab

Gene Symbol

Siglecg

Ensembl Gene

ENSMUSG00000030468

Gene Name

sialic acid binding Ig-like lectin G

Synonyms

mSiglec-G, A630096C01Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R5777 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43408204-43418358 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43409413 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 197 (S197P)

Ref Sequence

ENSEMBL: ENSMUSP00000005592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005592]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005592
AA Change: S197P

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000005592
Gene: ENSMUSG00000030468
AA Change: S197P

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	27	139	5.21e-2	SMART
IG_like	148	232	8.97e0	SMART
IGc2	262	325	3.38e-10	SMART
IGc2	366	427	8.26e-5	SMART
low complexity region	473	480	N/A	INTRINSIC
transmembrane domain	545	564	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123042

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124502

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124885

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131744

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154322

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agrp	T	C	8: 105,567,368	E41G	probably benign	Het
Amph	A	T	13: 19,046,016	N45Y	probably damaging	Het
Atp11a	T	A	8: 12,832,522	L470Q	probably damaging	Het
C130073F10Rik	T	A	4: 101,890,749	Y76F	possibly damaging	Het
Casp12	A	T	9: 5,354,548	I306F	probably benign	Het
Cobll1	A	T	2: 65,103,268	M460K	probably benign	Het
Col6a4	A	T	9: 106,013,696	L1800I	possibly damaging	Het
Ctdsp1	T	C	1: 74,394,068	V131A	probably damaging	Het
Ctnna3	A	G	10: 64,675,885	H618R	probably benign	Het
Dhx38	C	A	8: 109,556,902	V538L	possibly damaging	Het
Dtwd1	A	G	2: 126,159,813	D151G	probably damaging	Het
Fbxw28	A	G	9: 109,338,536	L51P	probably damaging	Het
Gm4781	C	T	10: 100,396,969		noncoding transcript	Het
Gm5134	C	A	10: 76,004,760	F479L	probably benign	Het
Hexa	T	G	9: 59,560,960	V290G	probably damaging	Het
Hist3h2ba	A	G	11: 58,949,009	K24E	probably benign	Het
Ifi206	C	T	1: 173,481,362	R356K	possibly damaging	Het
Kcnj12	G	A	11: 61,070,451	R525Q	possibly damaging	Het
Lrp2	A	T	2: 69,455,525	I3774N	probably damaging	Het
Msh4	C	A	3: 153,863,439	M832I	probably benign	Het
Myh10	A	G	11: 68,785,859	E852G	probably damaging	Het
Ndufaf1	A	T	2: 119,660,482	C32*	probably null	Het
Nos2	A	G	11: 78,940,152	E387G	probably null	Het
Olfr1062	A	G	2: 86,423,325	V117A	probably benign	Het
Olfr1311	C	T	2: 112,021,531	G108R	probably damaging	Het
Olfr1352	A	C	10: 78,984,678	D296A	possibly damaging	Het
Olfr197	T	A	16: 59,185,903	L193F	unknown	Het
Olfr545	A	G	7: 102,493,971	V268A	probably benign	Het
Olfr847	A	T	9: 19,375,718	H54Q	probably benign	Het
P3h3	T	C	6: 124,855,958	T211A	probably benign	Het
Pcdh7	A	G	5: 57,719,514	N137S	probably damaging	Het
Pgf	T	C	12: 85,169,374	T157A	possibly damaging	Het
Prex1	T	C	2: 166,586,659	D714G	probably damaging	Het
Scn7a	T	C	2: 66,692,569	I930M	probably damaging	Het
Skint7	T	A	4: 111,988,092	I367N	probably benign	Het
Slfn5	A	T	11: 82,961,004	D652V	probably damaging	Het
Stx1b	G	A	7: 127,810,918	Q3*	probably null	Het
Tex35	T	C	1: 157,107,207	M46V	probably benign	Het
Tkt	A	C	14: 30,558,776	T55P	possibly damaging	Het
Trim30c	T	C	7: 104,383,331	R263G	probably benign	Het
U2af2	G	A	7: 5,066,451	R33Q	probably benign	Het
Washc4	T	A	10: 83,555,605	V182D	probably damaging	Het
Xirp2	T	C	2: 67,510,004	V863A	possibly damaging	Het
Zfp976	T	G	7: 42,614,080	H111P	probably benign	Het
Zfp982	A	T	4: 147,510,864	N48Y	probably damaging	Het

Other mutations in Siglecg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00528:Siglecg	APN	7	43409057	missense	possibly damaging	0.64
IGL00556:Siglecg	APN	7	43411795	missense	probably benign	0.02
IGL01806:Siglecg	APN	7	43411464	splice site	probably null
IGL01947:Siglecg	APN	7	43408763	missense	probably benign	0.43
IGL02257:Siglecg	APN	7	43411904	missense	probably benign	0.00
IGL02410:Siglecg	APN	7	43408829	missense	probably damaging	0.99
IGL02454:Siglecg	APN	7	43408895	missense	probably benign	0.00
Chamonix	UTSW	7	43409422	missense	possibly damaging	0.91
Montblanc	UTSW	7	43411386	intron	probably benign
Shenandoah	UTSW	7	43408802	missense	probably damaging	0.99
shenandoah2	UTSW	7	43412017	missense	possibly damaging	0.82
Sherando	UTSW	7	43409057	missense	possibly damaging	0.64
Smokies	UTSW	7	43409279	missense	probably benign	0.02
IGL02988:Siglecg	UTSW	7	43418052	missense	probably damaging	1.00
R0134:Siglecg	UTSW	7	43411171	missense	probably damaging	1.00
R0225:Siglecg	UTSW	7	43411171	missense	probably damaging	1.00
R0480:Siglecg	UTSW	7	43411126	missense	probably benign	0.42
R1538:Siglecg	UTSW	7	43417889	missense	possibly damaging	0.53
R1681:Siglecg	UTSW	7	43408941	missense	probably benign	0.17
R2358:Siglecg	UTSW	7	43409422	missense	possibly damaging	0.91
R4428:Siglecg	UTSW	7	43417926	missense	possibly damaging	0.84
R4429:Siglecg	UTSW	7	43417926	missense	possibly damaging	0.84
R4736:Siglecg	UTSW	7	43417908	missense	probably benign	0.03
R4754:Siglecg	UTSW	7	43411871	intron	probably benign
R5017:Siglecg	UTSW	7	43411386	intron	probably benign
R5713:Siglecg	UTSW	7	43408802	missense	probably damaging	0.99
R5892:Siglecg	UTSW	7	43412204	intron	probably benign
R6153:Siglecg	UTSW	7	43412017	missense	possibly damaging	0.82
R6154:Siglecg	UTSW	7	43412017	missense	possibly damaging	0.82
R6331:Siglecg	UTSW	7	43408754	missense	possibly damaging	0.83
R6562:Siglecg	UTSW	7	43409057	missense	possibly damaging	0.64
R6749:Siglecg	UTSW	7	43408979	missense	probably benign	0.00
R7066:Siglecg	UTSW	7	43411742	missense	probably benign	0.40
R7884:Siglecg	UTSW	7	43409279	missense	probably benign	0.02
R8275:Siglecg	UTSW	7	43412468	missense	probably benign
R8554:Siglecg	UTSW	7	43408896	missense	probably benign	0.01
RF006:Siglecg	UTSW	7	43408864	nonsense	probably null
Z1177:Siglecg	UTSW	7	43412022	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACTACTTCTGGGAGGAGC -3'
(R):5'- AGCATGGAGTTGGGGAATTC -3'

Sequencing Primer
(F):5'- CGCTGGAGTCACAGGATTG -3'
(R):5'- GAGTTGGGGAATTCTCTACCTCC -3'

Posted On

2016-12-15