Incidental Mutation 'R5777:Stx1b'
ID446761
Institutional Source Beutler Lab
Gene Symbol Stx1b
Ensembl Gene ENSMUSG00000030806
Gene Namesyntaxin 1B
SynonymsStx1b2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R5777 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127803900-127824549 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 127810918 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 3 (Q3*)
Ref Sequence ENSEMBL: ENSMUSP00000145698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106267] [ENSMUST00000156135]
Predicted Effect probably null
Transcript: ENSMUST00000106267
AA Change: Q149*
SMART Domains Protein: ENSMUSP00000101874
Gene: ENSMUSG00000030806
AA Change: Q149*

DomainStartEndE-ValueType
SynN 24 145 1.99e-44 SMART
t_SNARE 186 253 4.32e-24 SMART
transmembrane domain 265 287 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000156135
AA Change: Q3*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206297
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of proteins thought to play a role in the exocytosis of synaptic vesicles. Vesicle exocytosis releases vesicular contents and is important to various cellular functions. For instance, the secretion of transmitters from neurons plays an important role in synaptic transmission. After exocytosis, the membrane and proteins from the vesicle are retrieved from the plasma membrane through the process of endocytosis. Mutations in this gene have been identified as one cause of fever-associated epilepsy syndromes. A possible link between this gene and Parkinson's disease has also been suggested. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele that encodes an 'open' syntaxin-1B protein conformation are viable but display severe ataxia, reduced chromaffin vesicle docking, accelerated synaptic vesicle fusion, and lethal epileptic seizures after 2 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrp T C 8: 105,567,368 E41G probably benign Het
Amph A T 13: 19,046,016 N45Y probably damaging Het
Atp11a T A 8: 12,832,522 L470Q probably damaging Het
C130073F10Rik T A 4: 101,890,749 Y76F possibly damaging Het
Casp12 A T 9: 5,354,548 I306F probably benign Het
Cobll1 A T 2: 65,103,268 M460K probably benign Het
Col6a4 A T 9: 106,013,696 L1800I possibly damaging Het
Ctdsp1 T C 1: 74,394,068 V131A probably damaging Het
Ctnna3 A G 10: 64,675,885 H618R probably benign Het
Dhx38 C A 8: 109,556,902 V538L possibly damaging Het
Dtwd1 A G 2: 126,159,813 D151G probably damaging Het
Fbxw28 A G 9: 109,338,536 L51P probably damaging Het
Gm4781 C T 10: 100,396,969 noncoding transcript Het
Gm5134 C A 10: 76,004,760 F479L probably benign Het
Hexa T G 9: 59,560,960 V290G probably damaging Het
Hist3h2ba A G 11: 58,949,009 K24E probably benign Het
Ifi206 C T 1: 173,481,362 R356K possibly damaging Het
Kcnj12 G A 11: 61,070,451 R525Q possibly damaging Het
Lrp2 A T 2: 69,455,525 I3774N probably damaging Het
Msh4 C A 3: 153,863,439 M832I probably benign Het
Myh10 A G 11: 68,785,859 E852G probably damaging Het
Ndufaf1 A T 2: 119,660,482 C32* probably null Het
Nos2 A G 11: 78,940,152 E387G probably null Het
Olfr1062 A G 2: 86,423,325 V117A probably benign Het
Olfr1311 C T 2: 112,021,531 G108R probably damaging Het
Olfr1352 A C 10: 78,984,678 D296A possibly damaging Het
Olfr197 T A 16: 59,185,903 L193F unknown Het
Olfr545 A G 7: 102,493,971 V268A probably benign Het
Olfr847 A T 9: 19,375,718 H54Q probably benign Het
P3h3 T C 6: 124,855,958 T211A probably benign Het
Pcdh7 A G 5: 57,719,514 N137S probably damaging Het
Pgf T C 12: 85,169,374 T157A possibly damaging Het
Prex1 T C 2: 166,586,659 D714G probably damaging Het
Scn7a T C 2: 66,692,569 I930M probably damaging Het
Siglecg T C 7: 43,409,413 S197P possibly damaging Het
Skint7 T A 4: 111,988,092 I367N probably benign Het
Slfn5 A T 11: 82,961,004 D652V probably damaging Het
Tex35 T C 1: 157,107,207 M46V probably benign Het
Tkt A C 14: 30,558,776 T55P possibly damaging Het
Trim30c T C 7: 104,383,331 R263G probably benign Het
U2af2 G A 7: 5,066,451 R33Q probably benign Het
Washc4 T A 10: 83,555,605 V182D probably damaging Het
Xirp2 T C 2: 67,510,004 V863A possibly damaging Het
Zfp976 T G 7: 42,614,080 H111P probably benign Het
Zfp982 A T 4: 147,510,864 N48Y probably damaging Het
Other mutations in Stx1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Stx1b APN 7 127810698 missense probably damaging 1.00
IGL02730:Stx1b APN 7 127815377 missense probably benign 0.37
IGL03394:Stx1b APN 7 127807884 missense probably damaging 1.00
R0680:Stx1b UTSW 7 127807723 missense possibly damaging 0.80
R1141:Stx1b UTSW 7 127810926 unclassified probably null
R1511:Stx1b UTSW 7 127814972 missense probably damaging 0.99
R2024:Stx1b UTSW 7 127815403 missense probably benign 0.00
R2116:Stx1b UTSW 7 127810905 missense probably damaging 1.00
R4964:Stx1b UTSW 7 127807921 missense probably damaging 1.00
R4966:Stx1b UTSW 7 127807921 missense probably damaging 1.00
R5385:Stx1b UTSW 7 127815403 missense probably benign 0.00
R5386:Stx1b UTSW 7 127815403 missense probably benign 0.00
R6092:Stx1b UTSW 7 127807863 missense possibly damaging 0.94
R6184:Stx1b UTSW 7 127807905 missense possibly damaging 0.79
R6688:Stx1b UTSW 7 127807896 missense probably damaging 1.00
R6843:Stx1b UTSW 7 127814979 nonsense probably null
R7493:Stx1b UTSW 7 127807359 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CATCAGTGAAGATGGCCAGC -3'
(R):5'- ACTAGGGTCCTGAATATATGTGGG -3'

Sequencing Primer
(F):5'- AGTAGTCCTGCCAGCTGTG -3'
(R):5'- GAGAGTGGTGCTGCAGC -3'
Posted On2016-12-15