Incidental Mutation 'R5777:Myh10'
ID446778
Institutional Source Beutler Lab
Gene Symbol Myh10
Ensembl Gene ENSMUSG00000020900
Gene Namemyosin, heavy polypeptide 10, non-muscle
SynonymsMyosin IIB, Fltn, Fltn, Myhn-2, myosin IIB, nonmuscle myosin heavy chain II-B, NMHC-B, Myhn2, SMemb, NMHC II-B, 5730504C04Rik, nonmuscle myosin heavy chain IIB, 9330167F11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5777 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location68691559-68816632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68785859 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 852 (E852G)
Ref Sequence ENSEMBL: ENSMUSP00000099671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018887] [ENSMUST00000092984] [ENSMUST00000102611]
Predicted Effect probably damaging
Transcript: ENSMUST00000018887
AA Change: E883G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000018887
Gene: ENSMUSG00000020900
AA Change: E883G

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.5e-15 PFAM
MYSc 79 815 N/A SMART
IQ 816 838 4.81e-4 SMART
low complexity region 932 946 N/A INTRINSIC
low complexity region 984 994 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1070 1086 N/A INTRINSIC
Pfam:Myosin_tail_1 1104 1961 6.5e-211 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092984
AA Change: E889G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090661
Gene: ENSMUSG00000020900
AA Change: E889G

DomainStartEndE-ValueType
Pfam:Myosin_N 70 110 2.5e-13 PFAM
MYSc 116 821 N/A SMART
IQ 822 844 4.81e-4 SMART
Pfam:Myosin_tail_1 885 1965 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102611
AA Change: E852G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099671
Gene: ENSMUSG00000020900
AA Change: E852G

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.4e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 4.81e-4 SMART
low complexity region 901 915 N/A INTRINSIC
low complexity region 953 963 N/A INTRINSIC
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1039 1055 N/A INTRINSIC
Pfam:Myosin_tail_1 1073 1930 6.2e-211 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145408
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-10 (MYO10). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene have been associated with May-Hegglin anomaly and developmental defects in brain and heart. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Nullizygous mice show pre- and neonatal death, heart defects and hydrocephaly. Deletion of exon B1 disrupts migration of facial neurons, whereas deletion of exon B2 leads to Purkinje cell anomalies. Hypomorphs show hydrocephaly and defects in motor control, cerebellar foliation and neuron migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrp T C 8: 105,567,368 E41G probably benign Het
Amph A T 13: 19,046,016 N45Y probably damaging Het
Atp11a T A 8: 12,832,522 L470Q probably damaging Het
C130073F10Rik T A 4: 101,890,749 Y76F possibly damaging Het
Casp12 A T 9: 5,354,548 I306F probably benign Het
Cobll1 A T 2: 65,103,268 M460K probably benign Het
Col6a4 A T 9: 106,013,696 L1800I possibly damaging Het
Ctdsp1 T C 1: 74,394,068 V131A probably damaging Het
Ctnna3 A G 10: 64,675,885 H618R probably benign Het
Dhx38 C A 8: 109,556,902 V538L possibly damaging Het
Dtwd1 A G 2: 126,159,813 D151G probably damaging Het
Fbxw28 A G 9: 109,338,536 L51P probably damaging Het
Gm4781 C T 10: 100,396,969 noncoding transcript Het
Gm5134 C A 10: 76,004,760 F479L probably benign Het
Hexa T G 9: 59,560,960 V290G probably damaging Het
Hist3h2ba A G 11: 58,949,009 K24E probably benign Het
Ifi206 C T 1: 173,481,362 R356K possibly damaging Het
Kcnj12 G A 11: 61,070,451 R525Q possibly damaging Het
Lrp2 A T 2: 69,455,525 I3774N probably damaging Het
Msh4 C A 3: 153,863,439 M832I probably benign Het
Ndufaf1 A T 2: 119,660,482 C32* probably null Het
Nos2 A G 11: 78,940,152 E387G probably null Het
Olfr1062 A G 2: 86,423,325 V117A probably benign Het
Olfr1311 C T 2: 112,021,531 G108R probably damaging Het
Olfr1352 A C 10: 78,984,678 D296A possibly damaging Het
Olfr197 T A 16: 59,185,903 L193F unknown Het
Olfr545 A G 7: 102,493,971 V268A probably benign Het
Olfr847 A T 9: 19,375,718 H54Q probably benign Het
P3h3 T C 6: 124,855,958 T211A probably benign Het
Pcdh7 A G 5: 57,719,514 N137S probably damaging Het
Pgf T C 12: 85,169,374 T157A possibly damaging Het
Prex1 T C 2: 166,586,659 D714G probably damaging Het
Scn7a T C 2: 66,692,569 I930M probably damaging Het
Siglecg T C 7: 43,409,413 S197P possibly damaging Het
Skint7 T A 4: 111,988,092 I367N probably benign Het
Slfn5 A T 11: 82,961,004 D652V probably damaging Het
Stx1b G A 7: 127,810,918 Q3* probably null Het
Tex35 T C 1: 157,107,207 M46V probably benign Het
Tkt A C 14: 30,558,776 T55P possibly damaging Het
Trim30c T C 7: 104,383,331 R263G probably benign Het
U2af2 G A 7: 5,066,451 R33Q probably benign Het
Washc4 T A 10: 83,555,605 V182D probably damaging Het
Xirp2 T C 2: 67,510,004 V863A possibly damaging Het
Zfp976 T G 7: 42,614,080 H111P probably benign Het
Zfp982 A T 4: 147,510,864 N48Y probably damaging Het
Other mutations in Myh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Myh10 APN 11 68790708 missense probably benign 0.10
IGL01132:Myh10 APN 11 68768268 missense possibly damaging 0.93
IGL01348:Myh10 APN 11 68811803 missense probably benign 0.04
IGL01404:Myh10 APN 11 68752040 splice site probably null
IGL01409:Myh10 APN 11 68807219 missense probably damaging 0.98
IGL01660:Myh10 APN 11 68785889 missense probably benign 0.00
IGL02111:Myh10 APN 11 68790112 missense probably damaging 1.00
IGL02481:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02483:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02502:Myh10 APN 11 68814372 splice site probably null
IGL03178:Myh10 APN 11 68699413 missense probably benign 0.19
algia UTSW 11 68802931 missense probably damaging 1.00
itis UTSW 11 68764245 missense probably damaging 0.96
PIT4802001:Myh10 UTSW 11 68765092 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0517:Myh10 UTSW 11 68811599 critical splice acceptor site probably null
R0855:Myh10 UTSW 11 68811801 missense possibly damaging 0.88
R1110:Myh10 UTSW 11 68791850 splice site probably benign
R1135:Myh10 UTSW 11 68807197 missense probably benign
R1169:Myh10 UTSW 11 68762841 missense probably damaging 0.99
R1643:Myh10 UTSW 11 68792010 missense probably damaging 0.96
R1733:Myh10 UTSW 11 68802296 missense probably benign 0.06
R1754:Myh10 UTSW 11 68813058 missense probably damaging 0.98
R1859:Myh10 UTSW 11 68745413 missense probably benign 0.03
R1898:Myh10 UTSW 11 68771906 missense probably damaging 1.00
R1905:Myh10 UTSW 11 68771868 splice site probably benign
R1914:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1915:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1987:Myh10 UTSW 11 68814496 missense possibly damaging 0.56
R2130:Myh10 UTSW 11 68807289 splice site probably benign
R2132:Myh10 UTSW 11 68807289 splice site probably benign
R2136:Myh10 UTSW 11 68804714 missense probably damaging 1.00
R2214:Myh10 UTSW 11 68783127 missense probably damaging 1.00
R2351:Myh10 UTSW 11 68793139 missense probably damaging 1.00
R3407:Myh10 UTSW 11 68790211 missense possibly damaging 0.68
R3721:Myh10 UTSW 11 68813052 missense probably damaging 0.99
R3908:Myh10 UTSW 11 68771059 critical splice donor site probably null
R4275:Myh10 UTSW 11 68751940 critical splice acceptor site probably null
R4526:Myh10 UTSW 11 68815049 missense probably benign 0.04
R4666:Myh10 UTSW 11 68801730 critical splice donor site probably null
R4668:Myh10 UTSW 11 68804642 missense probably damaging 1.00
R4750:Myh10 UTSW 11 68785314 missense probably damaging 1.00
R4968:Myh10 UTSW 11 68793223 missense probably damaging 1.00
R4977:Myh10 UTSW 11 68798371 missense possibly damaging 0.55
R5201:Myh10 UTSW 11 68783195 missense probably damaging 1.00
R5288:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5304:Myh10 UTSW 11 68764245 missense probably damaging 0.96
R5366:Myh10 UTSW 11 68760692 missense probably damaging 0.97
R5384:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5427:Myh10 UTSW 11 68802931 missense probably damaging 1.00
R5546:Myh10 UTSW 11 68798380 missense possibly damaging 0.90
R5551:Myh10 UTSW 11 68768287 missense possibly damaging 0.65
R5995:Myh10 UTSW 11 68814983 missense probably benign 0.01
R6021:Myh10 UTSW 11 68808862 missense possibly damaging 0.72
R6171:Myh10 UTSW 11 68791890 missense probably damaging 1.00
R6179:Myh10 UTSW 11 68802153 missense probably damaging 0.98
R6263:Myh10 UTSW 11 68810232 missense probably damaging 0.98
R6264:Myh10 UTSW 11 68745415 missense probably benign 0.01
R6484:Myh10 UTSW 11 68699467 missense probably damaging 1.00
R6575:Myh10 UTSW 11 68808850 missense probably benign 0.00
R6736:Myh10 UTSW 11 68745339 missense probably damaging 1.00
R7141:Myh10 UTSW 11 68802139 missense probably benign
R7256:Myh10 UTSW 11 68790689 missense probably damaging 1.00
R7329:Myh10 UTSW 11 68810191 missense probably benign 0.44
R7363:Myh10 UTSW 11 68815048 missense probably benign
R7576:Myh10 UTSW 11 68802166 missense probably damaging 1.00
R7577:Myh10 UTSW 11 68745980 missense unknown
R7681:Myh10 UTSW 11 68771936 missense probably damaging 0.98
R7813:Myh10 UTSW 11 68785909 missense probably benign 0.00
R7834:Myh10 UTSW 11 68785826 missense probably damaging 1.00
R7917:Myh10 UTSW 11 68785826 missense probably damaging 1.00
X0028:Myh10 UTSW 11 68793135 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGTCTTGCAGCGGAAC -3'
(R):5'- AATGAGAGAAAACCCTGCCCTG -3'

Sequencing Primer
(F):5'- ACTGTGCGGCGTACCTGAAG -3'
(R):5'- CTGTACCACAGGAGGCAGTG -3'
Posted On2016-12-15