Incidental Mutation 'R5777:Nos2'
ID446779
Institutional Source Beutler Lab
Gene Symbol Nos2
Ensembl Gene ENSMUSG00000020826
Gene Namenitric oxide synthase 2, inducible
SynonymsiNOS, Nos-2, Nos2a, NOS-II
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5777 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78920787-78960254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78940152 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 387 (E387G)
Ref Sequence ENSEMBL: ENSMUSP00000018610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018610] [ENSMUST00000214397]
PDB Structure
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DOMAIN (DELTA 114) (N-[(1,3-BENZODIOXOL-5-YL)METHYL]-1-[2-(1H-IMIDAZOL-1-YL)PYRIMIDIN-4-YL]-4-(METHOXYCARBONYL)-PIPERAZINE-2-ACETAMIDE COMPLEX [X-RAY DIFFRACTION]
MURINE INOSOXY DIMER WITH ISOTHIOUREA BOUND IN THE ACTIVE SITE [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND 4-AMINO TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND DIHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457F Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457A Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
inducible nitric oxide synthase with Chlorzoxazone bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 7-nitroindazole bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 6-nitroindazole bound [X-RAY DIFFRACTION]
>> 40 additional structures at PDB <<
Predicted Effect probably null
Transcript: ENSMUST00000018610
AA Change: E387G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018610
Gene: ENSMUSG00000020826
AA Change: E387G

DomainStartEndE-ValueType
Pfam:NO_synthase 129 491 6.7e-189 PFAM
Pfam:Flavodoxin_1 535 666 5.5e-43 PFAM
Pfam:FAD_binding_1 719 941 8.8e-79 PFAM
Pfam:NAD_binding_1 973 1087 4.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209121
Predicted Effect probably null
Transcript: ENSMUST00000214397
AA Change: E274G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase that is inducible by a combination of lipopolysaccharide and certain cytokines. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous deletion of this gene alters susceptibility to infection, response to injury, sepsis and sensory stimuli, cardiac function, osteoclast, platelet and mammary gland physiology, tumor growth, testis and uterus morphology, diet-induced atherosclerosis, and blood, urine and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrp T C 8: 105,567,368 E41G probably benign Het
Amph A T 13: 19,046,016 N45Y probably damaging Het
Atp11a T A 8: 12,832,522 L470Q probably damaging Het
C130073F10Rik T A 4: 101,890,749 Y76F possibly damaging Het
Casp12 A T 9: 5,354,548 I306F probably benign Het
Cobll1 A T 2: 65,103,268 M460K probably benign Het
Col6a4 A T 9: 106,013,696 L1800I possibly damaging Het
Ctdsp1 T C 1: 74,394,068 V131A probably damaging Het
Ctnna3 A G 10: 64,675,885 H618R probably benign Het
Dhx38 C A 8: 109,556,902 V538L possibly damaging Het
Dtwd1 A G 2: 126,159,813 D151G probably damaging Het
Fbxw28 A G 9: 109,338,536 L51P probably damaging Het
Gm4781 C T 10: 100,396,969 noncoding transcript Het
Gm5134 C A 10: 76,004,760 F479L probably benign Het
Hexa T G 9: 59,560,960 V290G probably damaging Het
Hist3h2ba A G 11: 58,949,009 K24E probably benign Het
Ifi206 C T 1: 173,481,362 R356K possibly damaging Het
Kcnj12 G A 11: 61,070,451 R525Q possibly damaging Het
Lrp2 A T 2: 69,455,525 I3774N probably damaging Het
Msh4 C A 3: 153,863,439 M832I probably benign Het
Myh10 A G 11: 68,785,859 E852G probably damaging Het
Ndufaf1 A T 2: 119,660,482 C32* probably null Het
Olfr1062 A G 2: 86,423,325 V117A probably benign Het
Olfr1311 C T 2: 112,021,531 G108R probably damaging Het
Olfr1352 A C 10: 78,984,678 D296A possibly damaging Het
Olfr197 T A 16: 59,185,903 L193F unknown Het
Olfr545 A G 7: 102,493,971 V268A probably benign Het
Olfr847 A T 9: 19,375,718 H54Q probably benign Het
P3h3 T C 6: 124,855,958 T211A probably benign Het
Pcdh7 A G 5: 57,719,514 N137S probably damaging Het
Pgf T C 12: 85,169,374 T157A possibly damaging Het
Prex1 T C 2: 166,586,659 D714G probably damaging Het
Scn7a T C 2: 66,692,569 I930M probably damaging Het
Siglecg T C 7: 43,409,413 S197P possibly damaging Het
Skint7 T A 4: 111,988,092 I367N probably benign Het
Slfn5 A T 11: 82,961,004 D652V probably damaging Het
Stx1b G A 7: 127,810,918 Q3* probably null Het
Tex35 T C 1: 157,107,207 M46V probably benign Het
Tkt A C 14: 30,558,776 T55P possibly damaging Het
Trim30c T C 7: 104,383,331 R263G probably benign Het
U2af2 G A 7: 5,066,451 R33Q probably benign Het
Washc4 T A 10: 83,555,605 V182D probably damaging Het
Xirp2 T C 2: 67,510,004 V863A possibly damaging Het
Zfp976 T G 7: 42,614,080 H111P probably benign Het
Zfp982 A T 4: 147,510,864 N48Y probably damaging Het
Other mutations in Nos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Nos2 APN 11 78957452 missense probably damaging 0.96
IGL01503:Nos2 APN 11 78945863 splice site probably benign
IGL01789:Nos2 APN 11 78944657 splice site probably benign
IGL02797:Nos2 APN 11 78940344 missense probably damaging 1.00
IGL02968:Nos2 APN 11 78937637 missense probably damaging 1.00
R0035:Nos2 UTSW 11 78945727 missense probably damaging 1.00
R0265:Nos2 UTSW 11 78937602 missense probably damaging 0.98
R0441:Nos2 UTSW 11 78928583 missense probably benign 0.10
R0504:Nos2 UTSW 11 78940077 missense probably damaging 1.00
R0570:Nos2 UTSW 11 78935361 missense possibly damaging 0.49
R1356:Nos2 UTSW 11 78952803 missense probably benign 0.00
R1538:Nos2 UTSW 11 78956570 missense probably benign 0.00
R3414:Nos2 UTSW 11 78957588 missense probably benign 0.14
R3418:Nos2 UTSW 11 78959695 missense possibly damaging 0.47
R4279:Nos2 UTSW 11 78929776 missense probably benign 0.01
R4492:Nos2 UTSW 11 78950095 missense probably benign
R4632:Nos2 UTSW 11 78957591 missense possibly damaging 0.95
R4686:Nos2 UTSW 11 78928630 missense possibly damaging 0.65
R5038:Nos2 UTSW 11 78922314 missense probably benign
R5214:Nos2 UTSW 11 78955441 missense probably damaging 1.00
R5377:Nos2 UTSW 11 78957491 missense probably benign 0.00
R5834:Nos2 UTSW 11 78928579 missense probably benign 0.01
R5930:Nos2 UTSW 11 78937915 missense probably damaging 1.00
R6511:Nos2 UTSW 11 78955464 splice site probably null
R6706:Nos2 UTSW 11 78944723 missense possibly damaging 0.60
R6747:Nos2 UTSW 11 78952954 missense probably damaging 0.99
R6762:Nos2 UTSW 11 78959748 missense possibly damaging 0.90
R6817:Nos2 UTSW 11 78945266 missense possibly damaging 0.64
R6868:Nos2 UTSW 11 78957506 missense probably benign 0.02
R6917:Nos2 UTSW 11 78951227 missense possibly damaging 0.50
R7082:Nos2 UTSW 11 78928579 missense probably benign 0.02
R7286:Nos2 UTSW 11 78929854 missense probably damaging 1.00
R7367:Nos2 UTSW 11 78950090 missense possibly damaging 0.77
R7398:Nos2 UTSW 11 78936471 nonsense probably null
R7411:Nos2 UTSW 11 78944855 critical splice donor site probably null
R7469:Nos2 UTSW 11 78952971 missense possibly damaging 0.94
R7736:Nos2 UTSW 11 78922366 nonsense probably null
X0063:Nos2 UTSW 11 78922367 missense probably benign 0.01
Z1177:Nos2 UTSW 11 78931672 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAAAGATGGCCCTAAGTGCAG -3'
(R):5'- AGCACAGCCACATTGATCTC -3'

Sequencing Primer
(F):5'- CTAAGTGCAGCTGGCTCTG -3'
(R):5'- GCCACATTGATCTCCGTGACAG -3'
Posted On2016-12-15