Incidental Mutation 'R5778:Lrrc7'
ID446801
Institutional Source Beutler Lab
Gene Symbol Lrrc7
Ensembl Gene ENSMUSG00000028176
Gene Nameleucine rich repeat containing 7
Synonymsdensin
MMRRC Submission 043376-MU
Accession Numbers

Genbank: NM_001081358; MGI: 2676665

Is this an essential gene? Possibly essential (E-score: 0.749) question?
Stock #R5778 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location158082891-158562221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 158170743 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 570 (L570P)
Ref Sequence ENSEMBL: ENSMUSP00000142498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106044] [ENSMUST00000199890] [ENSMUST00000200137]
Predicted Effect probably damaging
Transcript: ENSMUST00000106044
AA Change: L570P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101659
Gene: ENSMUSG00000028176
AA Change: L570P

DomainStartEndE-ValueType
LRR 53 73 3.65e0 SMART
LRR 96 118 2.2e1 SMART
LRR 142 164 4.21e1 SMART
LRR 165 187 7.36e0 SMART
LRR 188 210 7.05e-1 SMART
LRR 211 233 3.09e1 SMART
LRR 234 257 4.21e1 SMART
LRR 258 279 2.61e2 SMART
LRR 280 303 3.52e-1 SMART
LRR 326 349 1.99e0 SMART
LRR 372 394 2.63e0 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 1e-5 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1349 1378 2e-11 BLAST
PDZ 1460 1540 1.33e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199890
AA Change: L570P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142440
Gene: ENSMUSG00000028176
AA Change: L570P

DomainStartEndE-ValueType
LRR 53 73 3.65e0 SMART
LRR 96 118 2.2e1 SMART
LRR 142 164 4.21e1 SMART
LRR 165 187 7.36e0 SMART
LRR 188 210 7.05e-1 SMART
LRR 211 233 3.09e1 SMART
LRR 234 257 4.21e1 SMART
LRR 258 279 2.61e2 SMART
LRR 280 303 3.52e-1 SMART
LRR 326 349 1.99e0 SMART
LRR 372 394 2.63e0 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 9e-6 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1328 1364 1e-15 BLAST
low complexity region 1374 1387 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200137
AA Change: L570P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142498
Gene: ENSMUSG00000028176
AA Change: L570P

DomainStartEndE-ValueType
LRR 52 69 7.6e-1 SMART
LRR 73 92 4.2e-1 SMART
LRR 96 115 3.4e-1 SMART
LRR 142 164 1.8e-1 SMART
LRR 165 184 1.5e-1 SMART
LRR 188 207 2e-2 SMART
LRR 211 233 1.3e-1 SMART
LRR 234 257 1.7e-1 SMART
LRR 257 276 1e0 SMART
LRR 280 299 3.1e-2 SMART
LRR 303 322 6.6e-1 SMART
LRR 326 345 2.1e-1 SMART
LRR 372 391 1.2e-1 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 1e-5 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1302 1331 2e-11 BLAST
PDZ 1413 1493 6.4e-22 SMART
Predicted Effect unknown
Transcript: ENSMUST00000200196
AA Change: L558P
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, reduced long term depression, increased anxiety, increased aggression towards other mice, impaired spatial memory, decreased prepulse inhibition, decreased nesting building behavior, and abnormal dendritic spines. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 36,958,714 I1848F probably damaging Het
Acta1 A G 8: 123,892,125 S340P probably benign Het
Anpep T C 7: 79,836,391 T528A probably benign Het
Apob T A 12: 8,015,074 D4014E probably benign Het
Atp23 A G 10: 126,899,582 C78R probably damaging Het
Atp8b3 A G 10: 80,520,173 F1235S probably benign Het
B3gnt3 T C 8: 71,692,938 D262G probably benign Het
Brca1 G A 11: 101,525,301 A669V possibly damaging Het
Caprin2 A T 6: 148,869,322 S391R probably benign Het
Cdh15 G A 8: 122,856,587 R43Q possibly damaging Het
Celsr1 A T 15: 86,032,955 N272K probably damaging Het
Cryzl2 T G 1: 157,470,787 S249A probably benign Het
Dsg1b A T 18: 20,409,222 T929S possibly damaging Het
Dusp16 G T 6: 134,718,314 T518N probably benign Het
Eno2 A T 6: 124,766,298 H158Q probably damaging Het
Ep400 T C 5: 110,719,584 D954G unknown Het
Erg28 T C 12: 85,819,480 T75A possibly damaging Het
Fam135b T A 15: 71,479,032 T332S probably damaging Het
Fam19a3 T A 3: 104,772,189 K126N probably damaging Het
Fam221b A G 4: 43,660,683 F357L probably damaging Het
Fcgr2b C T 1: 170,963,388 G279R probably damaging Het
Fryl A T 5: 73,072,778 L1679M probably damaging Het
Galm T A 17: 80,127,717 M1K probably null Het
Gsg1 A T 6: 135,244,350 I17N possibly damaging Het
Hif3a A T 7: 17,051,984 I129N probably damaging Het
Ighv1-11 A T 12: 114,612,431 W55R probably damaging Het
Ighv1-20 C A 12: 114,723,877 K82N probably benign Het
Igsf21 C T 4: 140,037,521 E148K probably benign Het
Iltifb C A 10: 118,294,863 E43* probably null Het
Klhdc7b A T 15: 89,387,320 R802W probably damaging Het
Krt8 T C 15: 102,003,939 I101V probably damaging Het
Map4k1 C G 7: 28,994,221 N412K probably benign Het
Metrnl A T 11: 121,714,738 I118F possibly damaging Het
Mmp12 T A 9: 7,350,106 D202E probably damaging Het
Mpp2 A T 11: 102,064,443 S119T probably benign Het
Ncoa6 T C 2: 155,406,768 T1539A probably benign Het
Nlrc5 A G 8: 94,479,526 T715A possibly damaging Het
Nsd1 T A 13: 55,306,979 N1963K probably damaging Het
Nsd3 T C 8: 25,659,818 Y340H probably damaging Het
Nwd1 T A 8: 72,693,117 S977T probably damaging Het
Olfr1167 T A 2: 88,149,617 Y134F probably damaging Het
Olfr77 G T 9: 19,921,041 M277I probably benign Het
Pcdh8 T C 14: 79,770,757 E122G probably damaging Het
Pcmtd2 A C 2: 181,855,198 T323P probably benign Het
Pign C A 1: 105,591,722 G492C probably damaging Het
Plppr3 A G 10: 79,866,503 V245A possibly damaging Het
Prl7a2 C T 13: 27,661,000 W134* probably null Het
Prom1 A T 5: 44,007,047 N722K probably benign Het
Rasal2 A T 1: 157,161,290 N663K probably damaging Het
Rgl1 G T 1: 152,552,421 H315Q probably benign Het
Smpdl3a C A 10: 57,801,001 A65E probably damaging Het
Spdye4b G A 5: 143,202,387 D212N probably damaging Het
Tanc1 G T 2: 59,699,347 probably null Het
Trio A G 15: 27,856,164 V706A probably benign Het
Tshz1 T A 18: 84,015,680 Q201L probably damaging Het
Ubqln1 C T 13: 58,183,317 M365I probably benign Het
Usp42 A T 5: 143,719,576 Y383N probably damaging Het
Vmn1r189 A G 13: 22,102,382 I95T probably damaging Het
Vmn2r49 A T 7: 9,976,347 S819R probably damaging Het
Other mutations in Lrrc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Lrrc7 APN 3 158187010 missense probably benign 0.07
IGL00644:Lrrc7 APN 3 158202368 nonsense probably null
IGL00822:Lrrc7 APN 3 158185474 missense probably damaging 0.99
IGL00927:Lrrc7 APN 3 158161090 missense possibly damaging 0.94
IGL00946:Lrrc7 APN 3 158161356 missense probably benign 0.07
IGL00948:Lrrc7 APN 3 158161557 missense probably damaging 1.00
IGL01838:Lrrc7 APN 3 158185463 missense probably damaging 1.00
IGL01874:Lrrc7 APN 3 158240443 splice site probably benign
IGL02514:Lrrc7 APN 3 158160292 missense probably damaging 0.96
IGL02545:Lrrc7 APN 3 158185374 splice site probably benign
IGL02665:Lrrc7 APN 3 158161105 missense probably damaging 0.99
IGL03129:Lrrc7 APN 3 158161059 missense probably benign 0.02
N/A:Lrrc7 UTSW 3 158160340 missense probably benign
R0021:Lrrc7 UTSW 3 158160661 missense probably damaging 1.00
R0041:Lrrc7 UTSW 3 158164260 splice site probably benign
R0255:Lrrc7 UTSW 3 158160838 nonsense probably null
R0278:Lrrc7 UTSW 3 158179795 missense possibly damaging 0.96
R0409:Lrrc7 UTSW 3 158161426 missense possibly damaging 0.59
R0612:Lrrc7 UTSW 3 158164353 missense probably damaging 0.98
R0866:Lrrc7 UTSW 3 158164266 splice site probably benign
R1077:Lrrc7 UTSW 3 158161143 missense probably damaging 1.00
R1103:Lrrc7 UTSW 3 158148706 splice site probably benign
R1157:Lrrc7 UTSW 3 158160255 missense probably damaging 1.00
R1187:Lrrc7 UTSW 3 158160402 missense probably damaging 1.00
R1301:Lrrc7 UTSW 3 158135331 missense probably benign 0.20
R1433:Lrrc7 UTSW 3 158177306 missense probably damaging 1.00
R1450:Lrrc7 UTSW 3 158187044 missense possibly damaging 0.62
R1595:Lrrc7 UTSW 3 158177277 nonsense probably null
R1659:Lrrc7 UTSW 3 158161408 missense probably damaging 1.00
R1693:Lrrc7 UTSW 3 158084533 missense possibly damaging 0.95
R1774:Lrrc7 UTSW 3 158160292 missense possibly damaging 0.88
R2273:Lrrc7 UTSW 3 158187059 missense probably damaging 1.00
R2276:Lrrc7 UTSW 3 158179792 missense probably damaging 1.00
R2302:Lrrc7 UTSW 3 158135244 missense probably damaging 0.99
R2326:Lrrc7 UTSW 3 158170661 missense probably damaging 1.00
R2371:Lrrc7 UTSW 3 158161060 missense probably damaging 0.99
R2383:Lrrc7 UTSW 3 158163956 missense probably benign
R2679:Lrrc7 UTSW 3 158175108 nonsense probably null
R2698:Lrrc7 UTSW 3 158135391 missense probably benign 0.22
R2858:Lrrc7 UTSW 3 158161725 missense probably damaging 0.99
R3758:Lrrc7 UTSW 3 158163965 missense probably damaging 1.00
R3791:Lrrc7 UTSW 3 158163956 missense probably benign
R3805:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3806:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3807:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3892:Lrrc7 UTSW 3 158160696 missense probably benign 0.08
R3912:Lrrc7 UTSW 3 158291952 missense probably damaging 1.00
R3913:Lrrc7 UTSW 3 158291952 missense probably damaging 1.00
R3963:Lrrc7 UTSW 3 158160405 missense probably damaging 1.00
R4665:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4666:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4671:Lrrc7 UTSW 3 158202495 critical splice acceptor site probably null
R4688:Lrrc7 UTSW 3 158148605 missense probably damaging 1.00
R4725:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4726:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4728:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4783:Lrrc7 UTSW 3 158127213 critical splice donor site probably null
R4867:Lrrc7 UTSW 3 158161005 missense probably damaging 1.00
R4907:Lrrc7 UTSW 3 158161240 missense probably damaging 1.00
R5032:Lrrc7 UTSW 3 158181580 missense possibly damaging 0.85
R5107:Lrrc7 UTSW 3 158161896 missense probably damaging 1.00
R5295:Lrrc7 UTSW 3 158170739 missense probably damaging 1.00
R5348:Lrrc7 UTSW 3 158175326 missense probably benign 0.02
R5468:Lrrc7 UTSW 3 158318436 missense probably damaging 1.00
R5897:Lrrc7 UTSW 3 158164353 missense probably damaging 0.98
R6179:Lrrc7 UTSW 3 158353432 missense probably damaging 0.99
R6312:Lrrc7 UTSW 3 158160609 missense probably benign 0.04
R6313:Lrrc7 UTSW 3 158160736 missense probably damaging 1.00
R6366:Lrrc7 UTSW 3 158135375 missense probably benign 0.04
R6389:Lrrc7 UTSW 3 158185426 missense probably damaging 1.00
R6638:Lrrc7 UTSW 3 158135303 missense probably benign 0.20
R6956:Lrrc7 UTSW 3 158289031 missense probably benign 0.02
R6969:Lrrc7 UTSW 3 158156913 missense probably benign 0.19
R7073:Lrrc7 UTSW 3 158127247 missense probably damaging 1.00
R7313:Lrrc7 UTSW 3 158160474 missense probably damaging 1.00
R7365:Lrrc7 UTSW 3 158198161 missense probably damaging 1.00
R7398:Lrrc7 UTSW 3 158291958 nonsense probably null
R7403:Lrrc7 UTSW 3 158148674 nonsense probably null
R7407:Lrrc7 UTSW 3 158135241 missense probably damaging 1.00
R7427:Lrrc7 UTSW 3 158198141 missense probably benign 0.06
R7453:Lrrc7 UTSW 3 158185409 missense probably benign 0.00
R7461:Lrrc7 UTSW 3 158187020 missense probably benign 0.00
R7807:Lrrc7 UTSW 3 158160487 missense probably damaging 1.00
R7872:Lrrc7 UTSW 3 158353462 missense probably damaging 0.99
R8215:Lrrc7 UTSW 3 158209750 missense probably benign
R8367:Lrrc7 UTSW 3 158202370 missense possibly damaging 0.80
R8867:Lrrc7 UTSW 3 158161884 missense probably damaging 0.99
R8880:Lrrc7 UTSW 3 158161744 missense probably damaging 0.99
R8941:Lrrc7 UTSW 3 158163956 missense probably benign
R8958:Lrrc7 UTSW 3 158240501 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TAATCTCCTTTGGGGCCACC -3'
(R):5'- ACTGCTATTTCACTCACCTAAAGAC -3'

Sequencing Primer
(F):5'- ACCGGCCACTTGTGTTCAAAC -3'
(R):5'- GAGTTCAATATGCATCAAGCCC -3'
Posted On2016-12-15