Mutagenetix > Incidental Mutation

Incidental Mutation 'R5778:Nlrc5'

446823

Institutional Source

Beutler Lab

Gene Symbol

Nlrc5

Ensembl Gene

ENSMUSG00000074151

Gene Name

NLR family, CARD domain containing 5

Synonyms

AI451557

MMRRC Submission

043376-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5778 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

94434356-94527272 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 94479526 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 715 (T715A)

Ref Sequence

ENSEMBL: ENSMUSP00000148677 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053085] [ENSMUST00000182409] [ENSMUST00000211816]

AlphaFold

C3VPR6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053085
AA Change: T715A

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000138322
Gene: ENSMUSG00000074151
AA Change: T715A

Domain	Start	End	E-Value	Type
low complexity region	136	151	N/A	INTRINSIC
Pfam:NACHT	223	386	1.8e-32	PFAM
LRR	716	743	6.89e1	SMART
LRR	744	771	9.86e1	SMART
LRR	772	796	1.22e2	SMART
LRR	844	870	2.16e2	SMART
LRR	871	898	1.76e-1	SMART
LRR	1006	1033	1.9e0	SMART
LRR	1034	1061	4.51e1	SMART
low complexity region	1141	1169	N/A	INTRINSIC
LRR	1240	1267	2.67e1	SMART
LRR	1273	1295	1.22e1	SMART
low complexity region	1341	1351	N/A	INTRINSIC
LRR	1519	1546	5.48e1	SMART
LRR	1547	1574	3.36e1	SMART
LRR	1575	1602	1.69e1	SMART
LRR	1603	1630	8.99e-1	SMART
LRR	1631	1654	5.26e0	SMART
LRR	1659	1686	2.81e0	SMART
LRR	1687	1714	1.6e-4	SMART
LRR	1715	1742	1.06e0	SMART
LRR	1743	1768	8e0	SMART
LRR	1793	1820	2.06e1	SMART
LRR	1821	1848	5.42e-2	SMART
LRR	1849	1876	3.54e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182409
AA Change: T715A

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000183132

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211816
AA Change: T715A

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the caspase recruitment domain-containing NLR family. This gene plays a role in cytokine response and antiviral immunity through its inhibition of NF-kappa-B activation and negative regulation of type I interferon signaling pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal cytokine production induced by virus and bacteria infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	T	3: 36,958,714	I1848F	probably damaging	Het
Acta1	A	G	8: 123,892,125	S340P	probably benign	Het
Anpep	T	C	7: 79,836,391	T528A	probably benign	Het
Apob	T	A	12: 8,015,074	D4014E	probably benign	Het
Atp23	A	G	10: 126,899,582	C78R	probably damaging	Het
Atp8b3	A	G	10: 80,520,173	F1235S	probably benign	Het
B3gnt3	T	C	8: 71,692,938	D262G	probably benign	Het
Brca1	G	A	11: 101,525,301	A669V	possibly damaging	Het
Caprin2	A	T	6: 148,869,322	S391R	probably benign	Het
Cdh15	G	A	8: 122,856,587	R43Q	possibly damaging	Het
Celsr1	A	T	15: 86,032,955	N272K	probably damaging	Het
Cryzl2	T	G	1: 157,470,787	S249A	probably benign	Het
Dsg1b	A	T	18: 20,409,222	T929S	possibly damaging	Het
Dusp16	G	T	6: 134,718,314	T518N	probably benign	Het
Eno2	A	T	6: 124,766,298	H158Q	probably damaging	Het
Ep400	T	C	5: 110,719,584	D954G	unknown	Het
Erg28	T	C	12: 85,819,480	T75A	possibly damaging	Het
Fam135b	T	A	15: 71,479,032	T332S	probably damaging	Het
Fam19a3	T	A	3: 104,772,189	K126N	probably damaging	Het
Fam221b	A	G	4: 43,660,683	F357L	probably damaging	Het
Fcgr2b	C	T	1: 170,963,388	G279R	probably damaging	Het
Fryl	A	T	5: 73,072,778	L1679M	probably damaging	Het
Galm	T	A	17: 80,127,717	M1K	probably null	Het
Gsg1	A	T	6: 135,244,350	I17N	possibly damaging	Het
Hif3a	A	T	7: 17,051,984	I129N	probably damaging	Het
Ighv1-11	A	T	12: 114,612,431	W55R	probably damaging	Het
Ighv1-20	C	A	12: 114,723,877	K82N	probably benign	Het
Igsf21	C	T	4: 140,037,521	E148K	probably benign	Het
Iltifb	C	A	10: 118,294,863	E43*	probably null	Het
Klhdc7b	A	T	15: 89,387,320	R802W	probably damaging	Het
Krt8	T	C	15: 102,003,939	I101V	probably damaging	Het
Lrrc7	A	G	3: 158,170,743	L570P	probably damaging	Het
Map4k1	C	G	7: 28,994,221	N412K	probably benign	Het
Metrnl	A	T	11: 121,714,738	I118F	possibly damaging	Het
Mmp12	T	A	9: 7,350,106	D202E	probably damaging	Het
Mpp2	A	T	11: 102,064,443	S119T	probably benign	Het
Ncoa6	T	C	2: 155,406,768	T1539A	probably benign	Het
Nsd1	T	A	13: 55,306,979	N1963K	probably damaging	Het
Nsd3	T	C	8: 25,659,818	Y340H	probably damaging	Het
Nwd1	T	A	8: 72,693,117	S977T	probably damaging	Het
Olfr1167	T	A	2: 88,149,617	Y134F	probably damaging	Het
Olfr77	G	T	9: 19,921,041	M277I	probably benign	Het
Pcdh8	T	C	14: 79,770,757	E122G	probably damaging	Het
Pcmtd2	A	C	2: 181,855,198	T323P	probably benign	Het
Pign	C	A	1: 105,591,722	G492C	probably damaging	Het
Plppr3	A	G	10: 79,866,503	V245A	possibly damaging	Het
Prl7a2	C	T	13: 27,661,000	W134*	probably null	Het
Prom1	A	T	5: 44,007,047	N722K	probably benign	Het
Rasal2	A	T	1: 157,161,290	N663K	probably damaging	Het
Rgl1	G	T	1: 152,552,421	H315Q	probably benign	Het
Smpdl3a	C	A	10: 57,801,001	A65E	probably damaging	Het
Spdye4b	G	A	5: 143,202,387	D212N	probably damaging	Het
Tanc1	G	T	2: 59,699,347		probably null	Het
Trio	A	G	15: 27,856,164	V706A	probably benign	Het
Tshz1	T	A	18: 84,015,680	Q201L	probably damaging	Het
Ubqln1	C	T	13: 58,183,317	M365I	probably benign	Het
Usp42	A	T	5: 143,719,576	Y383N	probably damaging	Het
Vmn1r189	A	G	13: 22,102,382	I95T	probably damaging	Het
Vmn2r49	A	T	7: 9,976,347	S819R	probably damaging	Het

Other mutations in Nlrc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Nlrc5	APN	8	94502211	splice site	probably benign
IGL00232:Nlrc5	APN	8	94484623	critical splice donor site	probably null
IGL00324:Nlrc5	APN	8	94521479	missense	probably damaging	1.00
IGL02715:Nlrc5	APN	8	94474668	missense	probably damaging	1.00
IGL02992:Nlrc5	APN	8	94506573	missense	possibly damaging	0.69
IGL03095:Nlrc5	APN	8	94521908	splice site	probably benign
IGL03389:Nlrc5	APN	8	94521474	missense	probably damaging	1.00
IGL03406:Nlrc5	APN	8	94476855	missense	probably benign	0.01
cassis	UTSW	8	94476393	nonsense	probably null
cowberry	UTSW	8	94491525	missense	possibly damaging	0.83
lingon	UTSW	8	94481860	missense	probably damaging	1.00
R0037:Nlrc5	UTSW	8	94489535	missense	probably benign	0.00
R0048:Nlrc5	UTSW	8	94474656	missense	possibly damaging	0.81
R0092:Nlrc5	UTSW	8	94489594	splice site	probably benign
R0506:Nlrc5	UTSW	8	94493125	splice site	probably benign
R0548:Nlrc5	UTSW	8	94521783	missense	probably null	0.09
R2014:Nlrc5	UTSW	8	94525510	splice site	probably benign
R3051:Nlrc5	UTSW	8	94476715	missense	probably benign	0.01
R3776:Nlrc5	UTSW	8	94472839	missense	possibly damaging	0.48
R3837:Nlrc5	UTSW	8	94511301	splice site	probably benign
R4012:Nlrc5	UTSW	8	94475992	missense	possibly damaging	0.92
R4367:Nlrc5	UTSW	8	94476564	missense	probably damaging	1.00
R4400:Nlrc5	UTSW	8	94494353	missense	probably benign	0.08
R4469:Nlrc5	UTSW	8	94520839	missense	probably damaging	1.00
R4561:Nlrc5	UTSW	8	94477146	missense	probably damaging	1.00
R4584:Nlrc5	UTSW	8	94477275	missense	probably damaging	0.96
R4758:Nlrc5	UTSW	8	94512328	missense	possibly damaging	0.70
R4834:Nlrc5	UTSW	8	94505485	missense	probably benign	0.00
R4896:Nlrc5	UTSW	8	94521216	unclassified	probably benign
R5004:Nlrc5	UTSW	8	94521216	unclassified	probably benign
R5018:Nlrc5	UTSW	8	94525452	missense	probably damaging	1.00
R5115:Nlrc5	UTSW	8	94476819	missense	possibly damaging	0.67
R5116:Nlrc5	UTSW	8	94481860	missense	probably damaging	1.00
R5126:Nlrc5	UTSW	8	94474671	missense	possibly damaging	0.95
R5148:Nlrc5	UTSW	8	94476693	missense	probably damaging	1.00
R5224:Nlrc5	UTSW	8	94494316	missense	probably benign	0.26
R5527:Nlrc5	UTSW	8	94490416	missense	probably damaging	1.00
R5640:Nlrc5	UTSW	8	94475793	missense	probably benign	0.02
R5705:Nlrc5	UTSW	8	94475757	missense	probably benign	0.00
R5830:Nlrc5	UTSW	8	94472914	missense	probably damaging	1.00
R5850:Nlrc5	UTSW	8	94521047	missense	probably benign	0.00
R5978:Nlrc5	UTSW	8	94488593	missense	probably damaging	0.98
R6335:Nlrc5	UTSW	8	94502274	missense	probably benign	0.01
R6372:Nlrc5	UTSW	8	94479750	missense	probably damaging	0.98
R6486:Nlrc5	UTSW	8	94521299	splice site	probably null
R6765:Nlrc5	UTSW	8	94490368	missense	probably benign	0.20
R6861:Nlrc5	UTSW	8	94521229	unclassified	probably benign
R6869:Nlrc5	UTSW	8	94521955	missense	probably benign	0.00
R7134:Nlrc5	UTSW	8	94479722	missense	probably damaging	0.99
R7204:Nlrc5	UTSW	8	94491525	missense	possibly damaging	0.83
R7231:Nlrc5	UTSW	8	94521805	critical splice donor site	probably null
R7309:Nlrc5	UTSW	8	94474042	missense	probably benign	0.01
R7368:Nlrc5	UTSW	8	94476393	nonsense	probably null
R7497:Nlrc5	UTSW	8	94521970	missense	probably damaging	1.00
R7606:Nlrc5	UTSW	8	94477117	missense	possibly damaging	0.67
R7611:Nlrc5	UTSW	8	94512648	critical splice donor site	probably null
R7685:Nlrc5	UTSW	8	94521400	splice site	probably null
R7810:Nlrc5	UTSW	8	94505144	missense	possibly damaging	0.85
R7829:Nlrc5	UTSW	8	94521769	missense	probably damaging	1.00
R7910:Nlrc5	UTSW	8	94493092	missense	probably benign	0.00
R7921:Nlrc5	UTSW	8	94487664	missense	probably damaging	1.00
R8131:Nlrc5	UTSW	8	94481792	missense	probably damaging	1.00
R8237:Nlrc5	UTSW	8	94526125	missense	unknown
R8493:Nlrc5	UTSW	8	94523220	missense	probably damaging	1.00
R8888:Nlrc5	UTSW	8	94525490	missense	probably benign	0.04
R8964:Nlrc5	UTSW	8	94505488	missense	possibly damaging	0.54
R9053:Nlrc5	UTSW	8	94490385	missense	probably benign	0.00
R9058:Nlrc5	UTSW	8	94512310	missense	possibly damaging	0.86
R9161:Nlrc5	UTSW	8	94486646	missense	probably damaging	0.97
R9278:Nlrc5	UTSW	8	94511280	missense	probably benign	0.00
R9285:Nlrc5	UTSW	8	94472976	missense	probably damaging	1.00
R9405:Nlrc5	UTSW	8	94473024	missense	probably damaging	0.98
R9591:Nlrc5	UTSW	8	94522681	missense	probably damaging	1.00
R9620:Nlrc5	UTSW	8	94476406	missense	probably benign	0.44
RF021:Nlrc5	UTSW	8	94476888	missense	probably benign	0.16
Z1088:Nlrc5	UTSW	8	94504464	missense	possibly damaging	0.48
Z1177:Nlrc5	UTSW	8	94506580	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCCAACAACTACAGCGATGG -3'
(R):5'- GGGGCAATGTCTGTATCAGG -3'

Sequencing Primer
(F):5'- GCTCGTGATACAATGATGCC -3'
(R):5'- GCCTTGGGCTGTAATCCTAC -3'

Posted On

2016-12-15