Mutagenetix > Incidental Mutation

Incidental Mutation 'R5778:Cdh15'

446824

Institutional Source

Beutler Lab

Gene Symbol

Cdh15

Ensembl Gene

ENSMUSG00000031962

Gene Name

cadherin 15

Synonyms

M cadherin, Mcad, Cdh14

MMRRC Submission

043376-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5778 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

122847966-122867397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 122856587 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 43 (R43Q)

Ref Sequence

ENSEMBL: ENSMUSP00000034443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]

AlphaFold

P33146

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034443
AA Change: R43Q

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: R43Q

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	64	149	5.95e-18	SMART
CA	173	257	3.09e-25	SMART
CA	280	373	2.5e-11	SMART
CA	396	480	3.45e-14	SMART
Pfam:Cadherin	486	579	5.2e-9	PFAM
transmembrane domain	603	625	N/A	INTRINSIC
Pfam:Cadherin_C	633	783	6.7e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	T	3: 36,958,714	I1848F	probably damaging	Het
Acta1	A	G	8: 123,892,125	S340P	probably benign	Het
Anpep	T	C	7: 79,836,391	T528A	probably benign	Het
Apob	T	A	12: 8,015,074	D4014E	probably benign	Het
Atp23	A	G	10: 126,899,582	C78R	probably damaging	Het
Atp8b3	A	G	10: 80,520,173	F1235S	probably benign	Het
B3gnt3	T	C	8: 71,692,938	D262G	probably benign	Het
Brca1	G	A	11: 101,525,301	A669V	possibly damaging	Het
Caprin2	A	T	6: 148,869,322	S391R	probably benign	Het
Celsr1	A	T	15: 86,032,955	N272K	probably damaging	Het
Cryzl2	T	G	1: 157,470,787	S249A	probably benign	Het
Dsg1b	A	T	18: 20,409,222	T929S	possibly damaging	Het
Dusp16	G	T	6: 134,718,314	T518N	probably benign	Het
Eno2	A	T	6: 124,766,298	H158Q	probably damaging	Het
Ep400	T	C	5: 110,719,584	D954G	unknown	Het
Erg28	T	C	12: 85,819,480	T75A	possibly damaging	Het
Fam135b	T	A	15: 71,479,032	T332S	probably damaging	Het
Fam19a3	T	A	3: 104,772,189	K126N	probably damaging	Het
Fam221b	A	G	4: 43,660,683	F357L	probably damaging	Het
Fcgr2b	C	T	1: 170,963,388	G279R	probably damaging	Het
Fryl	A	T	5: 73,072,778	L1679M	probably damaging	Het
Galm	T	A	17: 80,127,717	M1K	probably null	Het
Gsg1	A	T	6: 135,244,350	I17N	possibly damaging	Het
Hif3a	A	T	7: 17,051,984	I129N	probably damaging	Het
Ighv1-11	A	T	12: 114,612,431	W55R	probably damaging	Het
Ighv1-20	C	A	12: 114,723,877	K82N	probably benign	Het
Igsf21	C	T	4: 140,037,521	E148K	probably benign	Het
Iltifb	C	A	10: 118,294,863	E43*	probably null	Het
Klhdc7b	A	T	15: 89,387,320	R802W	probably damaging	Het
Krt8	T	C	15: 102,003,939	I101V	probably damaging	Het
Lrrc7	A	G	3: 158,170,743	L570P	probably damaging	Het
Map4k1	C	G	7: 28,994,221	N412K	probably benign	Het
Metrnl	A	T	11: 121,714,738	I118F	possibly damaging	Het
Mmp12	T	A	9: 7,350,106	D202E	probably damaging	Het
Mpp2	A	T	11: 102,064,443	S119T	probably benign	Het
Ncoa6	T	C	2: 155,406,768	T1539A	probably benign	Het
Nlrc5	A	G	8: 94,479,526	T715A	possibly damaging	Het
Nsd1	T	A	13: 55,306,979	N1963K	probably damaging	Het
Nsd3	T	C	8: 25,659,818	Y340H	probably damaging	Het
Nwd1	T	A	8: 72,693,117	S977T	probably damaging	Het
Olfr1167	T	A	2: 88,149,617	Y134F	probably damaging	Het
Olfr77	G	T	9: 19,921,041	M277I	probably benign	Het
Pcdh8	T	C	14: 79,770,757	E122G	probably damaging	Het
Pcmtd2	A	C	2: 181,855,198	T323P	probably benign	Het
Pign	C	A	1: 105,591,722	G492C	probably damaging	Het
Plppr3	A	G	10: 79,866,503	V245A	possibly damaging	Het
Prl7a2	C	T	13: 27,661,000	W134*	probably null	Het
Prom1	A	T	5: 44,007,047	N722K	probably benign	Het
Rasal2	A	T	1: 157,161,290	N663K	probably damaging	Het
Rgl1	G	T	1: 152,552,421	H315Q	probably benign	Het
Smpdl3a	C	A	10: 57,801,001	A65E	probably damaging	Het
Spdye4b	G	A	5: 143,202,387	D212N	probably damaging	Het
Tanc1	G	T	2: 59,699,347		probably null	Het
Trio	A	G	15: 27,856,164	V706A	probably benign	Het
Tshz1	T	A	18: 84,015,680	Q201L	probably damaging	Het
Ubqln1	C	T	13: 58,183,317	M365I	probably benign	Het
Usp42	A	T	5: 143,719,576	Y383N	probably damaging	Het
Vmn1r189	A	G	13: 22,102,382	I95T	probably damaging	Het
Vmn2r49	A	T	7: 9,976,347	S819R	probably damaging	Het

Other mutations in Cdh15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cdh15	APN	8	122865323	intron	probably benign
IGL01958:Cdh15	APN	8	122859350	missense	probably damaging	1.00
IGL02588:Cdh15	APN	8	122856552	nonsense	probably null
IGL02793:Cdh15	APN	8	122860982	missense	probably damaging	1.00
IGL02947:Cdh15	APN	8	122865372	missense	probably benign	0.00
R0310:Cdh15	UTSW	8	122865436	missense	probably damaging	1.00
R0441:Cdh15	UTSW	8	122860966	missense	probably damaging	1.00
R0766:Cdh15	UTSW	8	122861449	intron	probably benign
R0898:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1023:Cdh15	UTSW	8	122865200	missense	probably damaging	0.98
R1054:Cdh15	UTSW	8	122864337	missense	possibly damaging	0.85
R1072:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R1081:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1101:Cdh15	UTSW	8	122860846	missense	possibly damaging	0.93
R1208:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1208:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1209:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1210:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1312:Cdh15	UTSW	8	122861449	intron	probably benign
R1317:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1318:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1393:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1428:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1429:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1695:Cdh15	UTSW	8	122862016	missense	probably benign	0.05
R2157:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2170:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2178:Cdh15	UTSW	8	122864976	splice site	probably null
R2252:Cdh15	UTSW	8	122857422	missense	probably damaging	1.00
R2290:Cdh15	UTSW	8	122859317	missense	probably damaging	1.00
R2317:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2330:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2345:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2349:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2353:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2354:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2566:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2567:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2568:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2893:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2894:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2937:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2938:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2990:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2992:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2993:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3029:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3030:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3195:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R3441:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3442:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3608:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3686:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R4119:Cdh15	UTSW	8	122863423	missense	probably damaging	1.00
R4120:Cdh15	UTSW	8	122863423	missense	probably damaging	1.00
R4477:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4478:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4480:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4580:Cdh15	UTSW	8	122865158	missense	probably damaging	0.99
R4583:Cdh15	UTSW	8	122865028	missense	probably damaging	0.98
R4619:Cdh15	UTSW	8	122860873	missense	probably damaging	1.00
R4694:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R4731:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R5076:Cdh15	UTSW	8	122864348	missense	possibly damaging	0.82
R5347:Cdh15	UTSW	8	122862063	missense	probably null	1.00
R5375:Cdh15	UTSW	8	122865100	missense	probably damaging	1.00
R5498:Cdh15	UTSW	8	122865178	missense	possibly damaging	0.79
R6320:Cdh15	UTSW	8	122864347	missense	probably benign	0.01
R6570:Cdh15	UTSW	8	122857391	missense	probably damaging	1.00
R6708:Cdh15	UTSW	8	122863555	missense	probably benign	0.32
R7505:Cdh15	UTSW	8	122848492	missense	probably benign	0.01
R7527:Cdh15	UTSW	8	122862126	missense	probably damaging	1.00
R7724:Cdh15	UTSW	8	122866961	missense	probably damaging	1.00
R8093:Cdh15	UTSW	8	122866835	missense	probably damaging	1.00
R8485:Cdh15	UTSW	8	122857366	missense	probably damaging	1.00
R8759:Cdh15	UTSW	8	122860889	missense	probably damaging	1.00
R8910:Cdh15	UTSW	8	122848501	missense	probably benign	0.04
R9017:Cdh15	UTSW	8	122857517	critical splice donor site	probably null
R9453:Cdh15	UTSW	8	122859290	missense	probably damaging	0.99
R9699:Cdh15	UTSW	8	122862030	missense	probably benign	0.00
R9705:Cdh15	UTSW	8	122864285	missense	probably damaging	1.00
Z1176:Cdh15	UTSW	8	122864259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTCCCCAGGTGGTATAGAG -3'
(R):5'- GGGCTTCCCTATATCCAAGAGG -3'

Sequencing Primer
(F):5'- GTATAGAGCCCGAGCACAGTC -3'
(R):5'- GAAGTCTTGAGTTCAATTCCCAGCG -3'

Posted On

2016-12-15