Incidental Mutation 'R5778:Mmp12'
ID446826
Institutional Source Beutler Lab
Gene Symbol Mmp12
Ensembl Gene ENSMUSG00000049723
Gene Namematrix metallopeptidase 12
SynonymsMmel, macrophage elastase, MMP12
MMRRC Submission 043376-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R5778 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location7344381-7369499 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7350106 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 202 (D202E)
Ref Sequence ENSEMBL: ENSMUSP00000065291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005950] [ENSMUST00000065079] [ENSMUST00000120655] [ENSMUST00000127722] [ENSMUST00000150167]
Predicted Effect probably damaging
Transcript: ENSMUST00000005950
AA Change: D202E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000005950
Gene: ENSMUSG00000049723
AA Change: D202E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:PG_binding_1 30 91 7.6e-22 PFAM
ZnMc 109 268 2.76e-57 SMART
low complexity region 269 284 N/A INTRINSIC
HX 292 334 1.44e-6 SMART
HX 336 379 2.03e-6 SMART
HX 384 431 2.29e-14 SMART
HX 433 473 2.94e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065079
AA Change: D202E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000065291
Gene: ENSMUSG00000049723
AA Change: D202E

DomainStartEndE-ValueType
Pfam:PG_binding_1 30 91 6.5e-22 PFAM
ZnMc 109 268 1.23e-54 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120655
AA Change: D132E

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114129
Gene: ENSMUSG00000049723
AA Change: D132E

DomainStartEndE-ValueType
Pfam:PG_binding_1 1 21 9.1e-9 PFAM
ZnMc 39 198 2.76e-57 SMART
low complexity region 199 214 N/A INTRINSIC
HX 222 264 1.44e-6 SMART
HX 266 309 2.03e-6 SMART
HX 314 361 2.29e-14 SMART
HX 363 403 2.94e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127722
SMART Domains Protein: ENSMUSP00000120225
Gene: ENSMUSG00000049723

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148005
Predicted Effect probably benign
Transcript: ENSMUST00000150167
SMART Domains Protein: ENSMUSP00000116080
Gene: ENSMUSG00000049723

DomainStartEndE-ValueType
Pfam:PG_binding_1 1 21 7.3e-10 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein have a diminished capacity to degrade extracellular matrix components, do not develop emphysema in response to long-term exposure to cigarette smoke, and exhibit impaired clearance and increased mortality upon bacterial infection. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. Alternate splicing generates multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased sensitivity to cigarette smoke, decreased littler size, abnormal myelination, abnormal macrophage physiology, and decreased oligodedrocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 36,958,714 I1848F probably damaging Het
Acta1 A G 8: 123,892,125 S340P probably benign Het
Anpep T C 7: 79,836,391 T528A probably benign Het
Apob T A 12: 8,015,074 D4014E probably benign Het
Atp23 A G 10: 126,899,582 C78R probably damaging Het
Atp8b3 A G 10: 80,520,173 F1235S probably benign Het
B3gnt3 T C 8: 71,692,938 D262G probably benign Het
Brca1 G A 11: 101,525,301 A669V possibly damaging Het
Caprin2 A T 6: 148,869,322 S391R probably benign Het
Cdh15 G A 8: 122,856,587 R43Q possibly damaging Het
Celsr1 A T 15: 86,032,955 N272K probably damaging Het
Cryzl2 T G 1: 157,470,787 S249A probably benign Het
Dsg1b A T 18: 20,409,222 T929S possibly damaging Het
Dusp16 G T 6: 134,718,314 T518N probably benign Het
Eno2 A T 6: 124,766,298 H158Q probably damaging Het
Ep400 T C 5: 110,719,584 D954G unknown Het
Erg28 T C 12: 85,819,480 T75A possibly damaging Het
Fam135b T A 15: 71,479,032 T332S probably damaging Het
Fam19a3 T A 3: 104,772,189 K126N probably damaging Het
Fam221b A G 4: 43,660,683 F357L probably damaging Het
Fcgr2b C T 1: 170,963,388 G279R probably damaging Het
Fryl A T 5: 73,072,778 L1679M probably damaging Het
Galm T A 17: 80,127,717 M1K probably null Het
Gsg1 A T 6: 135,244,350 I17N possibly damaging Het
Hif3a A T 7: 17,051,984 I129N probably damaging Het
Ighv1-11 A T 12: 114,612,431 W55R probably damaging Het
Ighv1-20 C A 12: 114,723,877 K82N probably benign Het
Igsf21 C T 4: 140,037,521 E148K probably benign Het
Iltifb C A 10: 118,294,863 E43* probably null Het
Klhdc7b A T 15: 89,387,320 R802W probably damaging Het
Krt8 T C 15: 102,003,939 I101V probably damaging Het
Lrrc7 A G 3: 158,170,743 L570P probably damaging Het
Map4k1 C G 7: 28,994,221 N412K probably benign Het
Metrnl A T 11: 121,714,738 I118F possibly damaging Het
Mpp2 A T 11: 102,064,443 S119T probably benign Het
Ncoa6 T C 2: 155,406,768 T1539A probably benign Het
Nlrc5 A G 8: 94,479,526 T715A possibly damaging Het
Nsd1 T A 13: 55,306,979 N1963K probably damaging Het
Nsd3 T C 8: 25,659,818 Y340H probably damaging Het
Nwd1 T A 8: 72,693,117 S977T probably damaging Het
Olfr1167 T A 2: 88,149,617 Y134F probably damaging Het
Olfr77 G T 9: 19,921,041 M277I probably benign Het
Pcdh8 T C 14: 79,770,757 E122G probably damaging Het
Pcmtd2 A C 2: 181,855,198 T323P probably benign Het
Pign C A 1: 105,591,722 G492C probably damaging Het
Plppr3 A G 10: 79,866,503 V245A possibly damaging Het
Prl7a2 C T 13: 27,661,000 W134* probably null Het
Prom1 A T 5: 44,007,047 N722K probably benign Het
Rasal2 A T 1: 157,161,290 N663K probably damaging Het
Rgl1 G T 1: 152,552,421 H315Q probably benign Het
Smpdl3a C A 10: 57,801,001 A65E probably damaging Het
Spdye4b G A 5: 143,202,387 D212N probably damaging Het
Tanc1 G T 2: 59,699,347 probably null Het
Trio A G 15: 27,856,164 V706A probably benign Het
Tshz1 T A 18: 84,015,680 Q201L probably damaging Het
Ubqln1 C T 13: 58,183,317 M365I probably benign Het
Usp42 A T 5: 143,719,576 Y383N probably damaging Het
Vmn1r189 A G 13: 22,102,382 I95T probably damaging Het
Vmn2r49 A T 7: 9,976,347 S819R probably damaging Het
Other mutations in Mmp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Mmp12 APN 9 7358307 missense possibly damaging 0.57
IGL03047:Mmp12 APN 9 7357797 splice site probably benign
IGL03224:Mmp12 APN 9 7350002 unclassified probably benign
IGL03247:Mmp12 APN 9 7348631 missense probably benign 0.05
R0050:Mmp12 UTSW 9 7350152 unclassified probably benign
R0480:Mmp12 UTSW 9 7350016 missense probably damaging 1.00
R0729:Mmp12 UTSW 9 7358290 missense possibly damaging 0.82
R0800:Mmp12 UTSW 9 7357827 missense possibly damaging 0.74
R1114:Mmp12 UTSW 9 7358289 missense possibly damaging 0.69
R1441:Mmp12 UTSW 9 7354787 missense probably damaging 0.98
R1765:Mmp12 UTSW 9 7354772 missense probably damaging 1.00
R2071:Mmp12 UTSW 9 7349725 missense probably damaging 1.00
R2102:Mmp12 UTSW 9 7349802 missense probably damaging 1.00
R2882:Mmp12 UTSW 9 7358236 missense probably damaging 1.00
R2936:Mmp12 UTSW 9 7357819 missense probably benign
R4645:Mmp12 UTSW 9 7347515 missense probably benign 0.04
R5210:Mmp12 UTSW 9 7349729 nonsense probably null
R5499:Mmp12 UTSW 9 7353000 missense probably benign 0.02
R5774:Mmp12 UTSW 9 7354823 missense possibly damaging 0.84
R5841:Mmp12 UTSW 9 7347501 missense possibly damaging 0.93
R5869:Mmp12 UTSW 9 7348446 intron probably benign
R6044:Mmp12 UTSW 9 7350050 missense possibly damaging 0.94
R6494:Mmp12 UTSW 9 7353479 missense probably damaging 0.99
R6651:Mmp12 UTSW 9 7355345 missense possibly damaging 0.62
R7057:Mmp12 UTSW 9 7357840 missense probably damaging 1.00
R7057:Mmp12 UTSW 9 7369173 missense probably benign 0.33
R8938:Mmp12 UTSW 9 7348446 intron probably benign
X0062:Mmp12 UTSW 9 7353013 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCCATTATGTGTGATGACCTG -3'
(R):5'- TCTTTGAGATCACGGCGTATC -3'

Sequencing Primer
(F):5'- CTGAGATGCCCTGTGACAGATG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2016-12-15