Mutagenetix > Incidental Mutation

Incidental Mutation 'R5778:Atp8b3'

446832

Institutional Source

Beutler Lab

Gene Symbol

Atp8b3

Ensembl Gene

ENSMUSG00000003341

Gene Name

ATPase, class I, type 8B, member 3

Synonyms

1700042F02Rik, SAPLT, 1700056N23Rik

MMRRC Submission

043376-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R5778 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80519584-80539124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80520173 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 1235 (F1235S)

Ref Sequence

ENSEMBL: ENSMUSP00000020383 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000051773] [ENSMUST00000220326]

AlphaFold

Q6UQ17

Predicted Effect

probably benign
Transcript: ENSMUST00000020383
AA Change: F1235S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: F1235S

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	20	97	9.3e-29	PFAM
Pfam:E1-E2_ATPase	121	367	2.2e-10	PFAM
Pfam:HAD	404	866	3.7e-17	PFAM
Pfam:Cation_ATPase	481	580	8.3e-12	PFAM
Pfam:PhoLip_ATPase_C	883	1135	4.2e-61	PFAM
low complexity region	1140	1153	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000051773

SMART Domains

Protein: ENSMUSP00000053288
Gene: ENSMUSG00000045518

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
low complexity region	56	76	N/A	INTRINSIC
low complexity region	98	116	N/A	INTRINSIC
low complexity region	126	151	N/A	INTRINSIC
low complexity region	190	227	N/A	INTRINSIC
CUT	310	395	1.24e-42	SMART
HOX	411	473	1.07e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220326

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	T	3: 36,958,714	I1848F	probably damaging	Het
Acta1	A	G	8: 123,892,125	S340P	probably benign	Het
Anpep	T	C	7: 79,836,391	T528A	probably benign	Het
Apob	T	A	12: 8,015,074	D4014E	probably benign	Het
Atp23	A	G	10: 126,899,582	C78R	probably damaging	Het
B3gnt3	T	C	8: 71,692,938	D262G	probably benign	Het
Brca1	G	A	11: 101,525,301	A669V	possibly damaging	Het
Caprin2	A	T	6: 148,869,322	S391R	probably benign	Het
Cdh15	G	A	8: 122,856,587	R43Q	possibly damaging	Het
Celsr1	A	T	15: 86,032,955	N272K	probably damaging	Het
Cryzl2	T	G	1: 157,470,787	S249A	probably benign	Het
Dsg1b	A	T	18: 20,409,222	T929S	possibly damaging	Het
Dusp16	G	T	6: 134,718,314	T518N	probably benign	Het
Eno2	A	T	6: 124,766,298	H158Q	probably damaging	Het
Ep400	T	C	5: 110,719,584	D954G	unknown	Het
Erg28	T	C	12: 85,819,480	T75A	possibly damaging	Het
Fam135b	T	A	15: 71,479,032	T332S	probably damaging	Het
Fam19a3	T	A	3: 104,772,189	K126N	probably damaging	Het
Fam221b	A	G	4: 43,660,683	F357L	probably damaging	Het
Fcgr2b	C	T	1: 170,963,388	G279R	probably damaging	Het
Fryl	A	T	5: 73,072,778	L1679M	probably damaging	Het
Galm	T	A	17: 80,127,717	M1K	probably null	Het
Gsg1	A	T	6: 135,244,350	I17N	possibly damaging	Het
Hif3a	A	T	7: 17,051,984	I129N	probably damaging	Het
Ighv1-11	A	T	12: 114,612,431	W55R	probably damaging	Het
Ighv1-20	C	A	12: 114,723,877	K82N	probably benign	Het
Igsf21	C	T	4: 140,037,521	E148K	probably benign	Het
Iltifb	C	A	10: 118,294,863	E43*	probably null	Het
Klhdc7b	A	T	15: 89,387,320	R802W	probably damaging	Het
Krt8	T	C	15: 102,003,939	I101V	probably damaging	Het
Lrrc7	A	G	3: 158,170,743	L570P	probably damaging	Het
Map4k1	C	G	7: 28,994,221	N412K	probably benign	Het
Metrnl	A	T	11: 121,714,738	I118F	possibly damaging	Het
Mmp12	T	A	9: 7,350,106	D202E	probably damaging	Het
Mpp2	A	T	11: 102,064,443	S119T	probably benign	Het
Ncoa6	T	C	2: 155,406,768	T1539A	probably benign	Het
Nlrc5	A	G	8: 94,479,526	T715A	possibly damaging	Het
Nsd1	T	A	13: 55,306,979	N1963K	probably damaging	Het
Nsd3	T	C	8: 25,659,818	Y340H	probably damaging	Het
Nwd1	T	A	8: 72,693,117	S977T	probably damaging	Het
Olfr1167	T	A	2: 88,149,617	Y134F	probably damaging	Het
Olfr77	G	T	9: 19,921,041	M277I	probably benign	Het
Pcdh8	T	C	14: 79,770,757	E122G	probably damaging	Het
Pcmtd2	A	C	2: 181,855,198	T323P	probably benign	Het
Pign	C	A	1: 105,591,722	G492C	probably damaging	Het
Plppr3	A	G	10: 79,866,503	V245A	possibly damaging	Het
Prl7a2	C	T	13: 27,661,000	W134*	probably null	Het
Prom1	A	T	5: 44,007,047	N722K	probably benign	Het
Rasal2	A	T	1: 157,161,290	N663K	probably damaging	Het
Rgl1	G	T	1: 152,552,421	H315Q	probably benign	Het
Smpdl3a	C	A	10: 57,801,001	A65E	probably damaging	Het
Spdye4b	G	A	5: 143,202,387	D212N	probably damaging	Het
Tanc1	G	T	2: 59,699,347		probably null	Het
Trio	A	G	15: 27,856,164	V706A	probably benign	Het
Tshz1	T	A	18: 84,015,680	Q201L	probably damaging	Het
Ubqln1	C	T	13: 58,183,317	M365I	probably benign	Het
Usp42	A	T	5: 143,719,576	Y383N	probably damaging	Het
Vmn1r189	A	G	13: 22,102,382	I95T	probably damaging	Het
Vmn2r49	A	T	7: 9,976,347	S819R	probably damaging	Het

Other mutations in Atp8b3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Atp8b3	APN	10	80530987	missense	probably damaging	1.00
IGL00484:Atp8b3	APN	10	80526164	splice site	probably benign
IGL00904:Atp8b3	APN	10	80528764	missense	probably damaging	1.00
IGL01326:Atp8b3	APN	10	80524376	missense	probably damaging	0.98
IGL01368:Atp8b3	APN	10	80534229	splice site	probably benign
IGL01448:Atp8b3	APN	10	80520422	missense	probably benign	0.02
IGL01556:Atp8b3	APN	10	80530968	nonsense	probably null
IGL01754:Atp8b3	APN	10	80530961	splice site	probably null
IGL01809:Atp8b3	APN	10	80520011	missense	probably benign	0.02
IGL01895:Atp8b3	APN	10	80521828	missense	possibly damaging	0.80
IGL02184:Atp8b3	APN	10	80527233	splice site	probably benign
IGL02224:Atp8b3	APN	10	80525976	splice site	probably benign
IGL02377:Atp8b3	APN	10	80520294	missense	probably benign	0.06
IGL02405:Atp8b3	APN	10	80530628	missense	probably damaging	1.00
IGL03090:Atp8b3	APN	10	80530604	missense	probably damaging	1.00
IGL03244:Atp8b3	APN	10	80534458	missense	probably damaging	1.00
PIT4544001:Atp8b3	UTSW	10	80530586	missense	probably benign	0.14
R0277:Atp8b3	UTSW	10	80526909	missense	probably benign	0.21
R0908:Atp8b3	UTSW	10	80520084	missense	probably benign	0.03
R0973:Atp8b3	UTSW	10	80534198	missense	probably damaging	1.00
R1069:Atp8b3	UTSW	10	80531018	missense	probably damaging	1.00
R1087:Atp8b3	UTSW	10	80520183	missense	probably benign	0.00
R1553:Atp8b3	UTSW	10	80532542	missense	probably damaging	1.00
R1603:Atp8b3	UTSW	10	80525785	missense	probably benign	0.06
R1606:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R1707:Atp8b3	UTSW	10	80521801	splice site	probably null
R1717:Atp8b3	UTSW	10	80528797	missense	probably damaging	1.00
R1876:Atp8b3	UTSW	10	80530078	missense	possibly damaging	0.70
R1939:Atp8b3	UTSW	10	80525386	nonsense	probably null
R2138:Atp8b3	UTSW	10	80527105	missense	possibly damaging	0.79
R2239:Atp8b3	UTSW	10	80530988	missense	probably damaging	1.00
R2429:Atp8b3	UTSW	10	80526894	missense	probably benign	0.02
R2696:Atp8b3	UTSW	10	80534183	missense	possibly damaging	0.94
R2910:Atp8b3	UTSW	10	80519912	missense	possibly damaging	0.90
R3424:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3425:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3432:Atp8b3	UTSW	10	80526180	missense	probably benign	0.10
R3841:Atp8b3	UTSW	10	80529706	missense	possibly damaging	0.95
R4515:Atp8b3	UTSW	10	80523847	missense	probably benign
R4518:Atp8b3	UTSW	10	80523847	missense	probably benign
R4519:Atp8b3	UTSW	10	80523847	missense	probably benign
R4619:Atp8b3	UTSW	10	80526024	missense	possibly damaging	0.67
R4648:Atp8b3	UTSW	10	80525623	missense	possibly damaging	0.94
R4709:Atp8b3	UTSW	10	80536770	splice site	probably null
R4774:Atp8b3	UTSW	10	80536322	missense	probably damaging	1.00
R4796:Atp8b3	UTSW	10	80524354	missense	probably damaging	1.00
R5000:Atp8b3	UTSW	10	80521842	missense	possibly damaging	0.82
R5398:Atp8b3	UTSW	10	80529699	missense	probably damaging	1.00
R5990:Atp8b3	UTSW	10	80525697	missense	possibly damaging	0.65
R6124:Atp8b3	UTSW	10	80529681	missense	probably damaging	1.00
R6427:Atp8b3	UTSW	10	80520323	splice site	probably null
R6748:Atp8b3	UTSW	10	80525224	missense	possibly damaging	0.56
R6756:Atp8b3	UTSW	10	80526061	missense	possibly damaging	0.76
R7051:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7051:Atp8b3	UTSW	10	80529718	missense	probably damaging	0.99
R7052:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7418:Atp8b3	UTSW	10	80530092	missense	probably damaging	0.99
R7426:Atp8b3	UTSW	10	80529629	critical splice donor site	probably null
R7625:Atp8b3	UTSW	10	80520146	missense	probably benign	0.00
R7673:Atp8b3	UTSW	10	80524406	missense	probably damaging	0.99
R7921:Atp8b3	UTSW	10	80530603	missense	probably damaging	1.00
R8077:Atp8b3	UTSW	10	80531024	missense	possibly damaging	0.95
R8235:Atp8b3	UTSW	10	80529816	missense	probably damaging	0.96
R8354:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8454:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8501:Atp8b3	UTSW	10	80520146	missense	probably benign
R8712:Atp8b3	UTSW	10	80530089	missense	possibly damaging	0.52
R8962:Atp8b3	UTSW	10	80520062	missense	probably benign	0.13
R9129:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R9333:Atp8b3	UTSW	10	80524346	missense	probably benign	0.01
R9438:Atp8b3	UTSW	10	80525575	missense	probably damaging	1.00
R9486:Atp8b3	UTSW	10	80530987	missense	probably damaging	1.00
R9554:Atp8b3	UTSW	10	80524363	missense	probably damaging	1.00
R9570:Atp8b3	UTSW	10	80525988	missense	probably benign	0.05
R9682:Atp8b3	UTSW	10	80535396	missense	probably damaging	1.00
R9748:Atp8b3	UTSW	10	80528573	missense	probably damaging	0.96
RF006:Atp8b3	UTSW	10	80526236	missense	probably benign	0.15
Z1177:Atp8b3	UTSW	10	80531077	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ATGAGGAGTGGACATCCGTG -3'
(R):5'- AGGGCTACGCAAACCTCATC -3'

Sequencing Primer
(F):5'- CCAGAGTGTACTGTGAAGCCAC -3'
(R):5'- GCAAACCTCATCACCCAGGG -3'

Posted On

2016-12-15