Incidental Mutation 'R5778:Tshz1'
ID446854
Institutional Source Beutler Lab
Gene Symbol Tshz1
Ensembl Gene ENSMUSG00000046982
Gene Nameteashirt zinc finger family member 1
SynonymsMtsh1, teashirt1, Sdccag33, D18Bwg1409e, Tsh1, NY-CO-33, 5730407I04Rik
MMRRC Submission 043376-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5778 (G1)
Quality Score210
Status Not validated
Chromosome18
Chromosomal Location84011627-84086404 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84015680 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 201 (Q201L)
Ref Sequence ENSEMBL: ENSMUSP00000089388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060303]
Predicted Effect probably damaging
Transcript: ENSMUST00000060303
AA Change: Q201L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089388
Gene: ENSMUSG00000046982
AA Change: Q201L

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 153 195 N/A INTRINSIC
ZnF_C2H2 246 270 1.86e0 SMART
ZnF_C2H2 307 331 3.83e-2 SMART
ZnF_C2H2 416 440 5.34e0 SMART
low complexity region 497 515 N/A INTRINSIC
HOX 890 964 4.15e-4 SMART
ZnF_C2H2 976 998 4.34e-1 SMART
ZnF_C2H2 1044 1067 4.47e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175783
SMART Domains Protein: ENSMUSP00000135640
Gene: ENSMUSG00000046982

DomainStartEndE-ValueType
ZnF_C2H2 43 67 1.7e-4 SMART
ZnF_C2H2 152 176 2.3e-2 SMART
low complexity region 233 251 N/A INTRINSIC
HOX 626 700 2.1e-6 SMART
ZnF_C2H2 712 734 1.9e-3 SMART
ZnF_C2H2 780 803 1.8e-5 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a colon cancer antigen that was defined by serological analysis of recombinant cDNA expression libraries. The encoded protein is a member of the teashirt C2H2-type zinc-finger protein family and may be involved in transcriptional regulation of developmental processes. Mutations in this gene may be associated with congenital aural atresia syndrome. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele die shortly after birth of respiratory distress, have defects in soft palate formation, have altered axial skeleton and have middle ear defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 36,958,714 I1848F probably damaging Het
Acta1 A G 8: 123,892,125 S340P probably benign Het
Anpep T C 7: 79,836,391 T528A probably benign Het
Apob T A 12: 8,015,074 D4014E probably benign Het
Atp23 A G 10: 126,899,582 C78R probably damaging Het
Atp8b3 A G 10: 80,520,173 F1235S probably benign Het
B3gnt3 T C 8: 71,692,938 D262G probably benign Het
Brca1 G A 11: 101,525,301 A669V possibly damaging Het
Caprin2 A T 6: 148,869,322 S391R probably benign Het
Cdh15 G A 8: 122,856,587 R43Q possibly damaging Het
Celsr1 A T 15: 86,032,955 N272K probably damaging Het
Cryzl2 T G 1: 157,470,787 S249A probably benign Het
Dsg1b A T 18: 20,409,222 T929S possibly damaging Het
Dusp16 G T 6: 134,718,314 T518N probably benign Het
Eno2 A T 6: 124,766,298 H158Q probably damaging Het
Ep400 T C 5: 110,719,584 D954G unknown Het
Erg28 T C 12: 85,819,480 T75A possibly damaging Het
Fam135b T A 15: 71,479,032 T332S probably damaging Het
Fam19a3 T A 3: 104,772,189 K126N probably damaging Het
Fam221b A G 4: 43,660,683 F357L probably damaging Het
Fcgr2b C T 1: 170,963,388 G279R probably damaging Het
Fryl A T 5: 73,072,778 L1679M probably damaging Het
Galm T A 17: 80,127,717 M1K probably null Het
Gsg1 A T 6: 135,244,350 I17N possibly damaging Het
Hif3a A T 7: 17,051,984 I129N probably damaging Het
Ighv1-11 A T 12: 114,612,431 W55R probably damaging Het
Ighv1-20 C A 12: 114,723,877 K82N probably benign Het
Igsf21 C T 4: 140,037,521 E148K probably benign Het
Iltifb C A 10: 118,294,863 E43* probably null Het
Klhdc7b A T 15: 89,387,320 R802W probably damaging Het
Krt8 T C 15: 102,003,939 I101V probably damaging Het
Lrrc7 A G 3: 158,170,743 L570P probably damaging Het
Map4k1 C G 7: 28,994,221 N412K probably benign Het
Metrnl A T 11: 121,714,738 I118F possibly damaging Het
Mmp12 T A 9: 7,350,106 D202E probably damaging Het
Mpp2 A T 11: 102,064,443 S119T probably benign Het
Ncoa6 T C 2: 155,406,768 T1539A probably benign Het
Nlrc5 A G 8: 94,479,526 T715A possibly damaging Het
Nsd1 T A 13: 55,306,979 N1963K probably damaging Het
Nsd3 T C 8: 25,659,818 Y340H probably damaging Het
Nwd1 T A 8: 72,693,117 S977T probably damaging Het
Olfr1167 T A 2: 88,149,617 Y134F probably damaging Het
Olfr77 G T 9: 19,921,041 M277I probably benign Het
Pcdh8 T C 14: 79,770,757 E122G probably damaging Het
Pcmtd2 A C 2: 181,855,198 T323P probably benign Het
Pign C A 1: 105,591,722 G492C probably damaging Het
Plppr3 A G 10: 79,866,503 V245A possibly damaging Het
Prl7a2 C T 13: 27,661,000 W134* probably null Het
Prom1 A T 5: 44,007,047 N722K probably benign Het
Rasal2 A T 1: 157,161,290 N663K probably damaging Het
Rgl1 G T 1: 152,552,421 H315Q probably benign Het
Smpdl3a C A 10: 57,801,001 A65E probably damaging Het
Spdye4b G A 5: 143,202,387 D212N probably damaging Het
Tanc1 G T 2: 59,699,347 probably null Het
Trio A G 15: 27,856,164 V706A probably benign Het
Ubqln1 C T 13: 58,183,317 M365I probably benign Het
Usp42 A T 5: 143,719,576 Y383N probably damaging Het
Vmn1r189 A G 13: 22,102,382 I95T probably damaging Het
Vmn2r49 A T 7: 9,976,347 S819R probably damaging Het
Other mutations in Tshz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Tshz1 APN 18 84013509 missense possibly damaging 0.94
IGL02934:Tshz1 APN 18 84013090 missense probably damaging 1.00
ANU18:Tshz1 UTSW 18 84014661 missense probably damaging 1.00
PIT4810001:Tshz1 UTSW 18 84013250 missense possibly damaging 0.85
R0052:Tshz1 UTSW 18 84014945 missense possibly damaging 0.76
R0052:Tshz1 UTSW 18 84014945 missense possibly damaging 0.76
R0364:Tshz1 UTSW 18 84016124 missense probably benign 0.31
R0391:Tshz1 UTSW 18 84016049 missense possibly damaging 0.93
R0515:Tshz1 UTSW 18 84015965 missense probably benign
R0942:Tshz1 UTSW 18 84013053 missense probably damaging 0.99
R0943:Tshz1 UTSW 18 84015231 missense probably benign 0.04
R1472:Tshz1 UTSW 18 84013805 missense possibly damaging 0.93
R1895:Tshz1 UTSW 18 84013433 missense probably damaging 1.00
R2022:Tshz1 UTSW 18 84013862 missense probably damaging 0.98
R2860:Tshz1 UTSW 18 84014980 missense probably damaging 1.00
R2861:Tshz1 UTSW 18 84014980 missense probably damaging 1.00
R4027:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4028:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4030:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4031:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4119:Tshz1 UTSW 18 84014189 missense probably benign 0.00
R4233:Tshz1 UTSW 18 84016195 missense probably benign 0.00
R4573:Tshz1 UTSW 18 84015082 missense probably damaging 1.00
R4604:Tshz1 UTSW 18 84013374 missense probably damaging 1.00
R4960:Tshz1 UTSW 18 84014862 missense probably benign 0.08
R5085:Tshz1 UTSW 18 84013928 missense probably benign 0.01
R5124:Tshz1 UTSW 18 84015467 missense probably damaging 1.00
R5150:Tshz1 UTSW 18 84013215 nonsense probably null
R5357:Tshz1 UTSW 18 84015080 missense probably damaging 1.00
R5530:Tshz1 UTSW 18 84013268 missense probably damaging 1.00
R5718:Tshz1 UTSW 18 84014524 missense probably damaging 1.00
R5750:Tshz1 UTSW 18 84013961 missense possibly damaging 0.93
R6052:Tshz1 UTSW 18 84014069 missense probably damaging 1.00
R6279:Tshz1 UTSW 18 84015311 missense probably damaging 1.00
R6393:Tshz1 UTSW 18 84013220 missense probably damaging 1.00
R6407:Tshz1 UTSW 18 84015966 missense possibly damaging 0.55
R6425:Tshz1 UTSW 18 84015563 missense probably damaging 0.99
R6998:Tshz1 UTSW 18 84015841 missense probably benign 0.00
R7165:Tshz1 UTSW 18 84015927 missense probably damaging 1.00
R7233:Tshz1 UTSW 18 84014819 missense possibly damaging 0.63
R7330:Tshz1 UTSW 18 84014831 missense probably damaging 0.96
R7491:Tshz1 UTSW 18 84015641 missense probably damaging 1.00
R7579:Tshz1 UTSW 18 84014665 nonsense probably null
R7592:Tshz1 UTSW 18 84014048 missense probably damaging 1.00
R7659:Tshz1 UTSW 18 84016075 missense probably damaging 0.97
R7702:Tshz1 UTSW 18 84014336 missense probably damaging 1.00
R7844:Tshz1 UTSW 18 84014171 missense probably benign 0.00
R7908:Tshz1 UTSW 18 84014607 nonsense probably null
R7927:Tshz1 UTSW 18 84014171 missense probably benign 0.00
R7989:Tshz1 UTSW 18 84014607 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATAGTGGCCTGTCTCGTTCATG -3'
(R):5'- AGTCCAATTCTGCCACCAG -3'

Sequencing Primer
(F):5'- CGTTCATGTGCACCGTCAG -3'
(R):5'- GCAACAACGATGCCAGCCAG -3'
Posted On2016-12-15