Mutagenetix > Incidental Mutations

Incidental Mutation 'R5779:Npas2'

446855

Institutional Source

Beutler Lab

Gene Symbol

Npas2

Ensembl Gene

ENSMUSG00000026077

Gene Name

neuronal PAS domain protein 2

Synonyms

bHLHe9, MOP4

MMRRC Submission

043377-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5779 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

39193731-39363236 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 39287571 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 46 (T46S)

Ref Sequence

ENSEMBL: ENSMUSP00000054719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056815] [ENSMUST00000173050]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000056815
AA Change: T46S

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000054719
Gene: ENSMUSG00000026077
AA Change: T46S

Domain	Start	End	E-Value	Type
HLH	15	65	6.56e-10	SMART
PAS	84	150	4.28e-10	SMART
PAS	239	305	4.03e-6	SMART
PAC	311	354	6.2e-7	SMART
low complexity region	400	419	N/A	INTRINSIC
coiled coil region	510	538	N/A	INTRINSIC
low complexity region	563	583	N/A	INTRINSIC
low complexity region	623	643	N/A	INTRINSIC
low complexity region	745	768	N/A	INTRINSIC
low complexity region	798	816	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173050
AA Change: T46S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000134241
Gene: ENSMUSG00000026077
AA Change: T46S

Domain	Start	End	E-Value	Type
HLH	15	60	1.08e-5	SMART

Meta Mutation Damage Score

0.1072

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

88% (52/59)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH)-PAS family of transcription factors. The encoded protein may play a regulatory role in the acquisition of specific types of memory. It also may function as a part of a molecular clock operative in the mammalian forebrain. [provided by RefSeq, Dec 2014]
PHENOTYPE: Targeted mutation of this gene results in deficits in complex emotional long-term memory tasks [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	T	17: 56,881,061	N190Y	probably benign	Het
2310035C23Rik	T	G	1: 105,687,347	N246K	probably damaging	Het
Abca6	T	C	11: 110,184,670	M1332V	probably benign	Het
Afg3l2	T	C	18: 67,440,443	K132R	probably null	Het
Arap3	T	C	18: 37,984,365	D886G	probably damaging	Het
B3gntl1	G	T	11: 121,651,676		probably null	Het
Cdk12	T	A	11: 98,219,074	S640R	probably benign	Het
Ceacam12	C	A	7: 18,069,154	P162T	probably benign	Het
Chrna5	C	A	9: 54,998,104	H67N	probably benign	Het
Copb1	T	A	7: 114,219,572	D837V	probably damaging	Het
D11Wsu47e	A	G	11: 113,687,992	D71G	probably benign	Het
Dcaf5	C	T	12: 80,338,832	R840H	probably benign	Het
Ect2l	T	A	10: 18,163,438	Q324L	probably benign	Het
Eef1e1	T	C	13: 38,646,273	N141S	probably damaging	Het
Eif2ak4	A	C	2: 118,412,963	N208T	possibly damaging	Het
Ext1	A	G	15: 53,344,553	Y271H	probably damaging	Het
Fam173a	A	G	17: 25,790,657	V194A	probably benign	Het
Fbxo5	G	A	10: 5,800,303	R323C	possibly damaging	Het
Fpr-rs3	C	A	17: 20,624,226	A218S	possibly damaging	Het
Gm20499	G	A	5: 114,817,021		probably benign	Het
Gucy1b2	C	A	14: 62,414,301	L400F	possibly damaging	Het
Hgd	T	A	16: 37,593,371	L24H	probably benign	Het
Hmx3	C	A	7: 131,544,328	S255*	probably null	Het
Ifrd1	A	T	12: 40,203,370	F448I	probably damaging	Het
Igfn1	T	A	1: 135,966,840	E1996V	probably benign	Het
Itpr1	G	A	6: 108,352,143	G173R	probably damaging	Het
Kbtbd8	T	C	6: 95,118,534	S26P	probably benign	Het
Kctd17	A	T	15: 78,437,133		probably benign	Het
Matr3	T	C	18: 35,584,522	S258P	possibly damaging	Het
Mpp4	G	A	1: 59,151,666	A90V	probably benign	Het
Mrpl20	G	A	4: 155,806,921	R34Q	probably damaging	Het
Neb	A	T	2: 52,245,301	S3266T	probably damaging	Het
Nipal3	A	G	4: 135,452,339		probably benign	Het
Nsd3	G	T	8: 25,682,669	E815*	probably null	Het
Nup98	C	A	7: 102,152,361	V786L	probably benign	Het
Olfr730	A	T	14: 50,186,746	M157K	possibly damaging	Het
Pcdhb3	T	C	18: 37,301,467	V162A	probably benign	Het
Pcgf2	G	A	11: 97,690,291	P58L	probably damaging	Het
Penk	A	G	4: 4,134,318	F110L	probably damaging	Het
Scfd1	A	G	12: 51,431,529	N508S	probably benign	Het
Scn2a	T	C	2: 65,764,483	V1892A	probably benign	Het
Sema6a	G	A	18: 47,248,826	R885C	probably damaging	Het
Sik2	T	C	9: 50,895,845	H755R	probably benign	Het
Slc36a3	A	T	11: 55,135,268	Y241*	probably null	Het
Smg5	T	C	3: 88,351,618		probably benign	Het
Spag9	A	G	11: 94,114,253	T1049A	probably benign	Het
Tas2r103	T	C	6: 133,036,945	M53V	probably benign	Het
Tpr	C	T	1: 150,423,541	A1090V	probably damaging	Het
Traf5	T	A	1: 191,997,672	R473W	probably damaging	Het
Ush2a	T	C	1: 188,443,510		probably null	Het
Vit	A	G	17: 78,546,426	T34A	probably benign	Het

Other mutations in Npas2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02560:Npas2	APN	1	39333961	splice site	probably benign
IGL02608:Npas2	APN	1	39345446	missense	probably benign	0.06
IGL02882:Npas2	APN	1	39312996	missense	probably benign	0.08
IGL02976:Npas2	APN	1	39287484	missense	probably damaging	1.00
IGL03130:Npas2	APN	1	39313028	missense	probably damaging	1.00
IGL03297:Npas2	APN	1	39292690	missense	possibly damaging	0.71
R1263:Npas2	UTSW	1	39334768	missense	possibly damaging	0.51
R1514:Npas2	UTSW	1	39311854	missense	possibly damaging	0.82
R1618:Npas2	UTSW	1	39300727	missense	probably damaging	1.00
R1620:Npas2	UTSW	1	39333912	missense	possibly damaging	0.68
R1844:Npas2	UTSW	1	39325375	missense	probably damaging	1.00
R1868:Npas2	UTSW	1	39300678	missense	probably benign	0.03
R1892:Npas2	UTSW	1	39345422	missense	probably benign	0.00
R2002:Npas2	UTSW	1	39338195	missense	probably benign	0.10
R3157:Npas2	UTSW	1	39347609	missense	possibly damaging	0.92
R3551:Npas2	UTSW	1	39287562	missense	probably benign	0.05
R4564:Npas2	UTSW	1	39287566	missense	probably damaging	1.00
R4907:Npas2	UTSW	1	39361985	missense	unknown
R5044:Npas2	UTSW	1	39347506	nonsense	probably null
R5621:Npas2	UTSW	1	39359713	missense	probably benign
R5822:Npas2	UTSW	1	39347566	missense	probably benign	0.00
R6033:Npas2	UTSW	1	39338180	missense	probably damaging	0.99
R6033:Npas2	UTSW	1	39338180	missense	probably damaging	0.99
R6155:Npas2	UTSW	1	39287476	missense	probably damaging	1.00
R6193:Npas2	UTSW	1	39292762	missense	probably damaging	1.00
R6220:Npas2	UTSW	1	39336061	missense	probably benign	0.00
R6341:Npas2	UTSW	1	39300687	missense	probably damaging	0.98
R6656:Npas2	UTSW	1	39361948	missense	unknown
R6778:Npas2	UTSW	1	39325300	missense	possibly damaging	0.92
R6803:Npas2	UTSW	1	39336049	missense	probably benign	0.35
R7165:Npas2	UTSW	1	39292717	missense	possibly damaging	0.79
R7250:Npas2	UTSW	1	39338107	missense	probably damaging	1.00
R7268:Npas2	UTSW	1	39287577	missense	probably damaging	0.98
R7284:Npas2	UTSW	1	39324467	missense	probably benign	0.36
R7833:Npas2	UTSW	1	39326147	missense	probably damaging	1.00
R7994:Npas2	UTSW	1	39328337	missense	possibly damaging	0.86
R8013:Npas2	UTSW	1	39338065	missense	probably benign
R8054:Npas2	UTSW	1	39287571	missense	possibly damaging	0.69
R8510:Npas2	UTSW	1	39287472	missense	probably damaging	1.00
R8683:Npas2	UTSW	1	39347627	missense	probably benign	0.00
R8738:Npas2	UTSW	1	39292716	missense	possibly damaging	0.65
R8779:Npas2	UTSW	1	39338186	missense	probably damaging	0.99
R9283:Npas2	UTSW	1	39287608	missense	probably damaging	1.00
Z1176:Npas2	UTSW	1	39336010	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TCTCCGTAGAAAACACCCTGAGAG -3'
(R):5'- ATGTCCAGAGCCTTTGGAGG -3'

Sequencing Primer
(F):5'- CCCTGAGAGAGAAGGAACCTCTG -3'
(R):5'- CTTTGGAGGAGAGCCCATG -3'

Posted On

2016-12-15