Incidental Mutation 'R5779:Mpp4'
ID446856
Institutional Source Beutler Lab
Gene Symbol Mpp4
Ensembl Gene ENSMUSG00000079550
Gene Namemembrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
SynonymsDLG6
MMRRC Submission 043377-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5779 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location59120935-59163389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59151666 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 90 (A90V)
Ref Sequence ENSEMBL: ENSMUSP00000140957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066374] [ENSMUST00000078874] [ENSMUST00000114275] [ENSMUST00000186477] [ENSMUST00000191200]
Predicted Effect probably benign
Transcript: ENSMUST00000066374
AA Change: A90V

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000070711
Gene: ENSMUSG00000079550
AA Change: A90V

DomainStartEndE-ValueType
L27 27 82 4.02e-9 SMART
L27 86 139 2.49e-14 SMART
PDZ 161 234 3.57e-11 SMART
SH3 244 310 2.94e-5 SMART
low complexity region 397 406 N/A INTRINSIC
GuKc 425 618 1.21e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078874
AA Change: A90V

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000077914
Gene: ENSMUSG00000079550
AA Change: A90V

DomainStartEndE-ValueType
L27 27 82 4.02e-9 SMART
L27 86 139 2.49e-14 SMART
PDZ 161 234 3.57e-11 SMART
SH3 244 310 2.94e-5 SMART
low complexity region 348 362 N/A INTRINSIC
low complexity region 397 406 N/A INTRINSIC
GuKc 425 618 1.21e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114275
AA Change: A109V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000109914
Gene: ENSMUSG00000079550
AA Change: A109V

DomainStartEndE-ValueType
L27 46 101 4.02e-9 SMART
L27 105 158 2.49e-14 SMART
PDZ 180 253 3.57e-11 SMART
SH3 263 329 2.94e-5 SMART
low complexity region 367 381 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
GuKc 444 637 1.21e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186477
AA Change: A90V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000140352
Gene: ENSMUSG00000079550
AA Change: A90V

DomainStartEndE-ValueType
L27 27 82 1.3e-11 SMART
L27 86 139 8.6e-17 SMART
PDZ 161 234 1.8e-13 SMART
SH3 222 297 5.1e-4 SMART
low complexity region 353 362 N/A INTRINSIC
GuKc 381 574 5.8e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190598
Predicted Effect probably benign
Transcript: ENSMUST00000191200
AA Change: A90V

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140957
Gene: ENSMUSG00000079550
AA Change: A90V

DomainStartEndE-ValueType
L27 27 82 4.02e-9 SMART
L27 86 139 2.49e-14 SMART
PDZ 161 234 3.57e-11 SMART
SH3 244 310 2.94e-5 SMART
low complexity region 342 356 N/A INTRINSIC
low complexity region 391 400 N/A INTRINSIC
GuKc 419 612 1.21e-50 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 88% (52/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) protein family, with an N-terminal PDZ domain, a central src homology 3 region (SH3), and a C-terminal guanylate kinase-like (GUK) domain. The protein is localized to the outer limiting membrane in the retina, and is thought to function in photoreceptor polarity and the organization of specialized intercellular junctions. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for mutations display sporadic photorecptor displacement. Correct protein localization at the presynaptic photoreceptor membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,881,061 N190Y probably benign Het
2310035C23Rik T G 1: 105,687,347 N246K probably damaging Het
Abca6 T C 11: 110,184,670 M1332V probably benign Het
Afg3l2 T C 18: 67,440,443 K132R probably null Het
Arap3 T C 18: 37,984,365 D886G probably damaging Het
B3gntl1 G T 11: 121,651,676 probably null Het
Cdk12 T A 11: 98,219,074 S640R probably benign Het
Ceacam12 C A 7: 18,069,154 P162T probably benign Het
Chrna5 C A 9: 54,998,104 H67N probably benign Het
Copb1 T A 7: 114,219,572 D837V probably damaging Het
D11Wsu47e A G 11: 113,687,992 D71G probably benign Het
Dcaf5 C T 12: 80,338,832 R840H probably benign Het
Ect2l T A 10: 18,163,438 Q324L probably benign Het
Eef1e1 T C 13: 38,646,273 N141S probably damaging Het
Eif2ak4 A C 2: 118,412,963 N208T possibly damaging Het
Ext1 A G 15: 53,344,553 Y271H probably damaging Het
Fam173a A G 17: 25,790,657 V194A probably benign Het
Fbxo5 G A 10: 5,800,303 R323C possibly damaging Het
Fpr-rs3 C A 17: 20,624,226 A218S possibly damaging Het
Gm20499 G A 5: 114,817,021 probably benign Het
Gucy1b2 C A 14: 62,414,301 L400F possibly damaging Het
Hgd T A 16: 37,593,371 L24H probably benign Het
Hmx3 C A 7: 131,544,328 S255* probably null Het
Ifrd1 A T 12: 40,203,370 F448I probably damaging Het
Igfn1 T A 1: 135,966,840 E1996V probably benign Het
Itpr1 G A 6: 108,352,143 G173R probably damaging Het
Kbtbd8 T C 6: 95,118,534 S26P probably benign Het
Kctd17 A T 15: 78,437,133 probably benign Het
Matr3 T C 18: 35,584,522 S258P possibly damaging Het
Mrpl20 G A 4: 155,806,921 R34Q probably damaging Het
Neb A T 2: 52,245,301 S3266T probably damaging Het
Nipal3 A G 4: 135,452,339 probably benign Het
Npas2 A T 1: 39,287,571 T46S possibly damaging Het
Nsd3 G T 8: 25,682,669 E815* probably null Het
Nup98 C A 7: 102,152,361 V786L probably benign Het
Olfr730 A T 14: 50,186,746 M157K possibly damaging Het
Pcdhb3 T C 18: 37,301,467 V162A probably benign Het
Pcgf2 G A 11: 97,690,291 P58L probably damaging Het
Penk A G 4: 4,134,318 F110L probably damaging Het
Scfd1 A G 12: 51,431,529 N508S probably benign Het
Scn2a T C 2: 65,764,483 V1892A probably benign Het
Sema6a G A 18: 47,248,826 R885C probably damaging Het
Sik2 T C 9: 50,895,845 H755R probably benign Het
Slc36a3 A T 11: 55,135,268 Y241* probably null Het
Smg5 T C 3: 88,351,618 probably benign Het
Spag9 A G 11: 94,114,253 T1049A probably benign Het
Tas2r103 T C 6: 133,036,945 M53V probably benign Het
Tpr C T 1: 150,423,541 A1090V probably damaging Het
Traf5 T A 1: 191,997,672 R473W probably damaging Het
Ush2a T C 1: 188,443,510 probably null Het
Vit A G 17: 78,546,426 T34A probably benign Het
Other mutations in Mpp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Mpp4 APN 1 59149519 critical splice donor site probably null
IGL01346:Mpp4 APN 1 59125560 missense probably damaging 1.00
IGL01680:Mpp4 APN 1 59130067 missense probably benign 0.21
IGL02123:Mpp4 APN 1 59161466 splice site probably null
IGL02299:Mpp4 APN 1 59158579 splice site probably benign
IGL02793:Mpp4 APN 1 59136834 splice site probably null
IGL02875:Mpp4 APN 1 59136834 splice site probably null
E0370:Mpp4 UTSW 1 59139758 splice site probably benign
R0391:Mpp4 UTSW 1 59143829 splice site probably benign
R0517:Mpp4 UTSW 1 59124727 nonsense probably null
R0725:Mpp4 UTSW 1 59121422 missense probably damaging 1.00
R0968:Mpp4 UTSW 1 59130090 missense probably damaging 1.00
R1753:Mpp4 UTSW 1 59144810 missense probably null 1.00
R1956:Mpp4 UTSW 1 59158652 missense probably benign 0.01
R1968:Mpp4 UTSW 1 59144802 missense probably damaging 1.00
R2062:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2064:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2065:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2068:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2088:Mpp4 UTSW 1 59123465 missense possibly damaging 0.68
R2108:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2426:Mpp4 UTSW 1 59130057 missense probably damaging 0.99
R2897:Mpp4 UTSW 1 59144694 missense probably benign
R2898:Mpp4 UTSW 1 59144694 missense probably benign
R3908:Mpp4 UTSW 1 59149037 missense probably damaging 0.99
R3938:Mpp4 UTSW 1 59124683 missense possibly damaging 0.94
R4050:Mpp4 UTSW 1 59146744 splice site probably null
R4396:Mpp4 UTSW 1 59144802 missense possibly damaging 0.56
R4908:Mpp4 UTSW 1 59125589 missense probably damaging 1.00
R5169:Mpp4 UTSW 1 59130097 critical splice acceptor site probably null
R5185:Mpp4 UTSW 1 59125583 missense probably benign 0.10
R5249:Mpp4 UTSW 1 59144858 splice site probably benign
R5333:Mpp4 UTSW 1 59157441 missense probably benign 0.03
R5563:Mpp4 UTSW 1 59124629 critical splice donor site probably null
R5829:Mpp4 UTSW 1 59128942 missense probably damaging 0.99
R5934:Mpp4 UTSW 1 59121376 missense probably damaging 1.00
R6017:Mpp4 UTSW 1 59121359 missense probably damaging 1.00
R6845:Mpp4 UTSW 1 59144804 missense probably benign 0.05
R7013:Mpp4 UTSW 1 59149615 missense probably damaging 1.00
R7292:Mpp4 UTSW 1 59143810 missense possibly damaging 0.51
R7775:Mpp4 UTSW 1 59123513 missense not run
R7778:Mpp4 UTSW 1 59123513 missense not run
R7912:Mpp4 UTSW 1 59121362 missense probably damaging 1.00
R7993:Mpp4 UTSW 1 59121362 missense probably damaging 1.00
X0013:Mpp4 UTSW 1 59123453 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ACCTAAGGTCAGTTAAATGCAAAGG -3'
(R):5'- TCACTTGTTTGGCTGTCAGC -3'

Sequencing Primer
(F):5'- TAAGAACACTGACTGCTCTTCCTGAG -3'
(R):5'- GCCACATCCTCCATATCAT -3'
Posted On2016-12-15