Mutagenetix > Incidental Mutation

Incidental Mutation 'R5779:Igfn1'

446858

Institutional Source

Beutler Lab

Gene Symbol

Igfn1

Ensembl Gene

ENSMUSG00000051985

Gene Name

immunoglobulin-like and fibronectin type III domain containing 1

Synonyms

9830123M21Rik

MMRRC Submission

043377-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R5779 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135953578-136006342 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 135966840 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 1996 (E1996V)

Ref Sequence

ENSEMBL: ENSMUSP00000129680 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166193]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000124134

SMART Domains

Protein: ENSMUSP00000119230
Gene: ENSMUSG00000051985

Domain	Start	End	E-Value	Type
IG	73	159	1.29e-6	SMART
IG_like	258	344	5.45e1	SMART
IG	354	435	1.79e0	SMART
IG	445	524	3.54e-4	SMART
IG	538	624	4.86e-2	SMART
FN3	627	711	3.99e-10	SMART
FN3	727	810	9.1e-14	SMART
FN3	828	911	1.5e-14	SMART
IG	938	1021	6.41e-2	SMART
FN3	1024	1106	3.2e-9	SMART
IGc2	1152	1219	4.89e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000140703

Predicted Effect

probably benign
Transcript: ENSMUST00000166193
AA Change: E1996V

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000129680
Gene: ENSMUSG00000051985
AA Change: E1996V

Domain	Start	End	E-Value	Type
low complexity region	90	101	N/A	INTRINSIC
IG	193	279	1.29e-6	SMART
PDB:2LHU\|A	302	365	8e-7	PDB
IG_like	378	464	5.45e1	SMART
IG	474	555	1.79e0	SMART
low complexity region	724	739	N/A	INTRINSIC
internal_repeat_2	838	1006	9.98e-5	PROSPERO
low complexity region	1067	1084	N/A	INTRINSIC
internal_repeat_2	1812	1967	9.98e-5	PROSPERO
Pfam:I-set	2054	2139	6.2e-8	PFAM
IG	2153	2239	4.86e-2	SMART
FN3	2242	2326	3.99e-10	SMART
FN3	2342	2425	9.1e-14	SMART
FN3	2443	2526	1.5e-14	SMART
IG	2553	2636	6.41e-2	SMART
FN3	2639	2721	3.2e-9	SMART
IGc2	2767	2834	4.89e-7	SMART

Meta Mutation Damage Score

0.1050

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

88% (52/59)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	T	17: 56,881,061	N190Y	probably benign	Het
2310035C23Rik	T	G	1: 105,687,347	N246K	probably damaging	Het
Abca6	T	C	11: 110,184,670	M1332V	probably benign	Het
Afg3l2	T	C	18: 67,440,443	K132R	probably null	Het
Arap3	T	C	18: 37,984,365	D886G	probably damaging	Het
B3gntl1	G	T	11: 121,651,676		probably null	Het
Cdk12	T	A	11: 98,219,074	S640R	probably benign	Het
Ceacam12	C	A	7: 18,069,154	P162T	probably benign	Het
Chrna5	C	A	9: 54,998,104	H67N	probably benign	Het
Copb1	T	A	7: 114,219,572	D837V	probably damaging	Het
D11Wsu47e	A	G	11: 113,687,992	D71G	probably benign	Het
Dcaf5	C	T	12: 80,338,832	R840H	probably benign	Het
Ect2l	T	A	10: 18,163,438	Q324L	probably benign	Het
Eef1e1	T	C	13: 38,646,273	N141S	probably damaging	Het
Eif2ak4	A	C	2: 118,412,963	N208T	possibly damaging	Het
Ext1	A	G	15: 53,344,553	Y271H	probably damaging	Het
Fam173a	A	G	17: 25,790,657	V194A	probably benign	Het
Fbxo5	G	A	10: 5,800,303	R323C	possibly damaging	Het
Fpr-rs3	C	A	17: 20,624,226	A218S	possibly damaging	Het
Gm20499	G	A	5: 114,817,021		probably benign	Het
Gucy1b2	C	A	14: 62,414,301	L400F	possibly damaging	Het
Hgd	T	A	16: 37,593,371	L24H	probably benign	Het
Hmx3	C	A	7: 131,544,328	S255*	probably null	Het
Ifrd1	A	T	12: 40,203,370	F448I	probably damaging	Het
Itpr1	G	A	6: 108,352,143	G173R	probably damaging	Het
Kbtbd8	T	C	6: 95,118,534	S26P	probably benign	Het
Kctd17	A	T	15: 78,437,133		probably benign	Het
Matr3	T	C	18: 35,584,522	S258P	possibly damaging	Het
Mpp4	G	A	1: 59,151,666	A90V	probably benign	Het
Mrpl20	G	A	4: 155,806,921	R34Q	probably damaging	Het
Neb	A	T	2: 52,245,301	S3266T	probably damaging	Het
Nipal3	A	G	4: 135,452,339		probably benign	Het
Npas2	A	T	1: 39,287,571	T46S	possibly damaging	Het
Nsd3	G	T	8: 25,682,669	E815*	probably null	Het
Nup98	C	A	7: 102,152,361	V786L	probably benign	Het
Olfr730	A	T	14: 50,186,746	M157K	possibly damaging	Het
Pcdhb3	T	C	18: 37,301,467	V162A	probably benign	Het
Pcgf2	G	A	11: 97,690,291	P58L	probably damaging	Het
Penk	A	G	4: 4,134,318	F110L	probably damaging	Het
Scfd1	A	G	12: 51,431,529	N508S	probably benign	Het
Scn2a	T	C	2: 65,764,483	V1892A	probably benign	Het
Sema6a	G	A	18: 47,248,826	R885C	probably damaging	Het
Sik2	T	C	9: 50,895,845	H755R	probably benign	Het
Slc36a3	A	T	11: 55,135,268	Y241*	probably null	Het
Smg5	T	C	3: 88,351,618		probably benign	Het
Spag9	A	G	11: 94,114,253	T1049A	probably benign	Het
Tas2r103	T	C	6: 133,036,945	M53V	probably benign	Het
Tpr	C	T	1: 150,423,541	A1090V	probably damaging	Het
Traf5	T	A	1: 191,997,672	R473W	probably damaging	Het
Ush2a	T	C	1: 188,443,510		probably null	Het
Vit	A	G	17: 78,546,426	T34A	probably benign	Het

Other mutations in Igfn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Igfn1	APN	1	135966726	missense	probably damaging	1.00
IGL02299:Igfn1	APN	1	135954017	utr 3 prime	probably benign
Bounty	UTSW	1	135976917	critical splice donor site	probably null
R2276_Igfn1_773	UTSW	1	135964741	missense	probably damaging	0.98
R4058_Igfn1_315	UTSW	1	135969756	missense	probably benign	0.07
R0144:Igfn1	UTSW	1	135962013	missense	probably damaging	0.99
R0190:Igfn1	UTSW	1	135962052	missense	probably damaging	1.00
R0350:Igfn1	UTSW	1	135956767	nonsense	probably null
R0413:Igfn1	UTSW	1	135967596	missense	probably benign	0.23
R0504:Igfn1	UTSW	1	135968529	missense	probably benign	0.00
R0606:Igfn1	UTSW	1	135959901	missense	probably damaging	1.00
R0681:Igfn1	UTSW	1	135963853	missense	possibly damaging	0.88
R0825:Igfn1	UTSW	1	135963126	missense	probably damaging	1.00
R0839:Igfn1	UTSW	1	135954680	missense	probably damaging	1.00
R1066:Igfn1	UTSW	1	135970725	missense	probably benign
R1078:Igfn1	UTSW	1	135974847	missense	probably damaging	1.00
R1224:Igfn1	UTSW	1	135969756	missense	probably benign	0.07
R1569:Igfn1	UTSW	1	135969033	missense	probably benign
R1626:Igfn1	UTSW	1	135968967	missense	probably benign	0.29
R1663:Igfn1	UTSW	1	135968308	missense	probably benign	0.15
R1677:Igfn1	UTSW	1	135971101	missense	probably damaging	0.99
R1709:Igfn1	UTSW	1	135955573	missense	probably benign	0.24
R1728:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1728:Igfn1	UTSW	1	135968199	missense	probably benign
R1728:Igfn1	UTSW	1	135970411	missense	probably benign
R1728:Igfn1	UTSW	1	135972127	missense	probably benign
R1728:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1728:Igfn1	UTSW	1	135982475	missense	probably benign
R1728:Igfn1	UTSW	1	135998625	missense	probably benign
R1728:Igfn1	UTSW	1	135998683	missense	unknown
R1729:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1729:Igfn1	UTSW	1	135968199	missense	probably benign
R1729:Igfn1	UTSW	1	135970411	missense	probably benign
R1729:Igfn1	UTSW	1	135972127	missense	probably benign
R1729:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1729:Igfn1	UTSW	1	135982475	missense	probably benign
R1729:Igfn1	UTSW	1	135998625	missense	probably benign
R1729:Igfn1	UTSW	1	135998683	missense	unknown
R1730:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1730:Igfn1	UTSW	1	135968199	missense	probably benign
R1730:Igfn1	UTSW	1	135970411	missense	probably benign
R1730:Igfn1	UTSW	1	135972127	missense	probably benign
R1730:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1730:Igfn1	UTSW	1	135982475	missense	probably benign
R1730:Igfn1	UTSW	1	135998625	missense	probably benign
R1730:Igfn1	UTSW	1	135998683	missense	unknown
R1739:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1739:Igfn1	UTSW	1	135968199	missense	probably benign
R1739:Igfn1	UTSW	1	135970411	missense	probably benign
R1739:Igfn1	UTSW	1	135972127	missense	probably benign
R1739:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1739:Igfn1	UTSW	1	135982475	missense	probably benign
R1739:Igfn1	UTSW	1	135998625	missense	probably benign
R1739:Igfn1	UTSW	1	135998683	missense	unknown
R1746:Igfn1	UTSW	1	135969823	missense	possibly damaging	0.88
R1762:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1762:Igfn1	UTSW	1	135968199	missense	probably benign
R1762:Igfn1	UTSW	1	135970411	missense	probably benign
R1762:Igfn1	UTSW	1	135972127	missense	probably benign
R1762:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1762:Igfn1	UTSW	1	135982475	missense	probably benign
R1762:Igfn1	UTSW	1	135998625	missense	probably benign
R1762:Igfn1	UTSW	1	135998683	missense	unknown
R1783:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1783:Igfn1	UTSW	1	135968199	missense	probably benign
R1783:Igfn1	UTSW	1	135970411	missense	probably benign
R1783:Igfn1	UTSW	1	135972127	missense	probably benign
R1783:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1783:Igfn1	UTSW	1	135982475	missense	probably benign
R1783:Igfn1	UTSW	1	135998625	missense	probably benign
R1783:Igfn1	UTSW	1	135998683	missense	unknown
R1784:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1784:Igfn1	UTSW	1	135968199	missense	probably benign
R1784:Igfn1	UTSW	1	135970411	missense	probably benign
R1784:Igfn1	UTSW	1	135972127	missense	probably benign
R1784:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1784:Igfn1	UTSW	1	135982475	missense	probably benign
R1784:Igfn1	UTSW	1	135998625	missense	probably benign
R1784:Igfn1	UTSW	1	135998683	missense	unknown
R1785:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1785:Igfn1	UTSW	1	135968199	missense	probably benign
R1785:Igfn1	UTSW	1	135970411	missense	probably benign
R1785:Igfn1	UTSW	1	135972127	missense	probably benign
R1785:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1785:Igfn1	UTSW	1	135982475	missense	probably benign
R1785:Igfn1	UTSW	1	135998625	missense	probably benign
R1785:Igfn1	UTSW	1	135998683	missense	unknown
R1847:Igfn1	UTSW	1	135969388	missense	probably benign
R1866:Igfn1	UTSW	1	135974868	splice site	probably null
R1921:Igfn1	UTSW	1	135966063	critical splice donor site	probably null
R1984:Igfn1	UTSW	1	135962044	missense	probably benign	0.39
R2049:Igfn1	UTSW	1	135970638	missense	probably benign
R2049:Igfn1	UTSW	1	135974852	splice site	probably benign
R2098:Igfn1	UTSW	1	135978305	missense	probably damaging	1.00
R2130:Igfn1	UTSW	1	135974852	splice site	probably benign
R2141:Igfn1	UTSW	1	135974852	splice site	probably benign
R2276:Igfn1	UTSW	1	135964741	missense	probably damaging	0.98
R2425:Igfn1	UTSW	1	135963102	missense	probably damaging	1.00
R2483:Igfn1	UTSW	1	135969537	missense	probably benign
R2504:Igfn1	UTSW	1	135969316	missense	probably benign	0.07
R3109:Igfn1	UTSW	1	135997848	missense	probably benign	0.12
R3421:Igfn1	UTSW	1	135976917	critical splice donor site	probably null
R3423:Igfn1	UTSW	1	135998641	missense	probably benign	0.01
R3705:Igfn1	UTSW	1	135968409	missense	probably benign
R3871:Igfn1	UTSW	1	135968836	missense	probably benign	0.03
R3875:Igfn1	UTSW	1	135954614	missense	probably damaging	1.00
R3953:Igfn1	UTSW	1	135967180	missense	possibly damaging	0.61
R3955:Igfn1	UTSW	1	135967180	missense	possibly damaging	0.61
R3957:Igfn1	UTSW	1	135967180	missense	possibly damaging	0.61
R3965:Igfn1	UTSW	1	135967819	missense	probably benign
R4006:Igfn1	UTSW	1	135982362	splice site	probably null
R4058:Igfn1	UTSW	1	135969756	missense	probably benign	0.07
R4059:Igfn1	UTSW	1	135969756	missense	probably benign	0.07
R4370:Igfn1	UTSW	1	135968106	missense	probably benign	0.00
R4380:Igfn1	UTSW	1	135967771	missense	probably benign	0.00
R4495:Igfn1	UTSW	1	135969678	missense	possibly damaging	0.79
R4628:Igfn1	UTSW	1	135959730	missense	possibly damaging	0.47
R4672:Igfn1	UTSW	1	135965369	missense	possibly damaging	0.72
R4682:Igfn1	UTSW	1	135998625	missense	probably benign
R4702:Igfn1	UTSW	1	135967209	missense	possibly damaging	0.71
R4744:Igfn1	UTSW	1	135982458	missense	probably benign	0.07
R4777:Igfn1	UTSW	1	135954862	missense	probably benign
R4806:Igfn1	UTSW	1	135967357	missense	probably benign	0.01
R4840:Igfn1	UTSW	1	135968040	missense	probably benign	0.00
R4894:Igfn1	UTSW	1	135954782	missense	probably damaging	1.00
R4998:Igfn1	UTSW	1	135954666	missense	probably damaging	1.00
R5092:Igfn1	UTSW	1	135964826	missense	probably benign
R5108:Igfn1	UTSW	1	135982441	missense	probably benign
R5120:Igfn1	UTSW	1	135973502	missense	possibly damaging	0.93
R5127:Igfn1	UTSW	1	135959896	missense	probably damaging	1.00
R5231:Igfn1	UTSW	1	135966736	missense	probably benign	0.26
R5286:Igfn1	UTSW	1	135967861	missense	probably benign	0.10
R5307:Igfn1	UTSW	1	135964938	missense	probably damaging	1.00
R5380:Igfn1	UTSW	1	135966087	missense	probably damaging	1.00
R5553:Igfn1	UTSW	1	135967884	missense	probably damaging	1.00
R5660:Igfn1	UTSW	1	135970414	missense	probably benign	0.01
R5818:Igfn1	UTSW	1	135966126	missense	possibly damaging	0.72
R5832:Igfn1	UTSW	1	135974795	missense	probably damaging	0.96
R5933:Igfn1	UTSW	1	135970603	nonsense	probably null
R5966:Igfn1	UTSW	1	135965414	missense	probably damaging	1.00
R6116:Igfn1	UTSW	1	135970467	missense	probably benign	0.00
R6297:Igfn1	UTSW	1	135964661	critical splice donor site	probably null
R6652:Igfn1	UTSW	1	135963871	missense	probably damaging	1.00
R6737:Igfn1	UTSW	1	135969867	missense	probably benign
R6816:Igfn1	UTSW	1	135959728	missense	probably benign	0.02
R6886:Igfn1	UTSW	1	135973460	missense	probably damaging	1.00
R6888:Igfn1	UTSW	1	135982480	missense	probably benign	0.33
R6975:Igfn1	UTSW	1	135968445	missense	probably damaging	0.96
R7105:Igfn1	UTSW	1	135984218	missense	probably benign	0.11
R7114:Igfn1	UTSW	1	135966781	missense	probably benign	0.01
R7233:Igfn1	UTSW	1	135970135	missense	probably benign	0.41
R7276:Igfn1	UTSW	1	135998638	missense	possibly damaging	0.85
R7354:Igfn1	UTSW	1	135976032	missense	possibly damaging	0.72
R7358:Igfn1	UTSW	1	135964000	missense	probably damaging	1.00
R7380:Igfn1	UTSW	1	135962008	missense	probably damaging	1.00
R7389:Igfn1	UTSW	1	135967047	missense	probably benign	0.00
R7513:Igfn1	UTSW	1	135959967	missense	probably damaging	1.00
R7718:Igfn1	UTSW	1	135969036	missense	probably benign
R7769:Igfn1	UTSW	1	135982405	missense	possibly damaging	0.85
R7810:Igfn1	UTSW	1	135974789	missense	probably damaging	0.98
R7917:Igfn1	UTSW	1	135971968	missense	probably damaging	0.99
R7952:Igfn1	UTSW	1	135963955	missense	probably damaging	0.99
R8041:Igfn1	UTSW	1	135968059	nonsense	probably null
R8233:Igfn1	UTSW	1	135968044	missense	probably benign	0.00
R8354:Igfn1	UTSW	1	135959881	missense	possibly damaging	0.61
R8363:Igfn1	UTSW	1	135963887	missense	probably benign	0.01
R8428:Igfn1	UTSW	1	135967782	missense	probably damaging	1.00
R8731:Igfn1	UTSW	1	135997836	missense	probably benign	0.02
R8756:Igfn1	UTSW	1	135967960	missense	probably benign	0.10
R8797:Igfn1	UTSW	1	135974835	missense	possibly damaging	0.93
R8913:Igfn1	UTSW	1	135963841	missense	possibly damaging	0.90
R8927:Igfn1	UTSW	1	135978246	missense	probably damaging	1.00
R8928:Igfn1	UTSW	1	135978246	missense	probably damaging	1.00
R9087:Igfn1	UTSW	1	135974868	splice site	probably null
R9109:Igfn1	UTSW	1	135998589	missense	probably benign	0.26
R9113:Igfn1	UTSW	1	135955590	missense	probably damaging	1.00
R9117:Igfn1	UTSW	1	135974790	missense	probably benign	0.03
R9205:Igfn1	UTSW	1	135975957	missense	probably damaging	0.96
R9260:Igfn1	UTSW	1	135979956	missense	probably benign	0.45
R9275:Igfn1	UTSW	1	135973447	missense	probably damaging	0.96
R9277:Igfn1	UTSW	1	135959782	missense	probably damaging	0.98
R9278:Igfn1	UTSW	1	135973447	missense	probably damaging	0.96
R9287:Igfn1	UTSW	1	135997806	missense	probably benign	0.33
R9298:Igfn1	UTSW	1	135998589	missense	probably benign	0.26
R9356:Igfn1	UTSW	1	135972087	nonsense	probably null
R9371:Igfn1	UTSW	1	135978263	missense	probably damaging	1.00
R9532:Igfn1	UTSW	1	135969491	missense	possibly damaging	0.61
Z1176:Igfn1	UTSW	1	135972000	missense	probably damaging	0.99
Z1177:Igfn1	UTSW	1	135955809	missense	probably damaging	1.00
Z1177:Igfn1	UTSW	1	135969567	missense	probably benign	0.26
Z1177:Igfn1	UTSW	1	135982426	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- TCCAAGGACTCTACCCTCTG -3'
(R):5'- GCCTCAGCAAAGTTTGAAAACC -3'

Sequencing Primer
(F):5'- TCTGGCTCCACCCTATAAGAG -3'
(R):5'- CTCAGCAAAGTTTGAAAACCAGGGAG -3'

Posted On

2016-12-15