Incidental Mutation 'R0544:Slc5a2'
ID44686
Institutional Source Beutler Lab
Gene Symbol Slc5a2
Ensembl Gene ENSMUSG00000030781
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 2
SynonymsSglt2
MMRRC Submission 038736-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0544 (G1)
Quality Score157
Status Validated
Chromosome7
Chromosomal Location128265657-128272430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128269999 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 317 (Y317F)
Ref Sequence ENSEMBL: ENSMUSP00000112597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033044] [ENSMUST00000033045] [ENSMUST00000118169] [ENSMUST00000126263] [ENSMUST00000137038] [ENSMUST00000142841] [ENSMUST00000153418] [ENSMUST00000205720] [ENSMUST00000206909]
Predicted Effect probably benign
Transcript: ENSMUST00000033044
SMART Domains Protein: ENSMUSP00000033044
Gene: ENSMUSG00000030780

DomainStartEndE-ValueType
Pfam:DUF647 62 301 5.6e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033045
AA Change: Y276F

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably damaging
Transcript: ENSMUST00000118169
AA Change: Y317F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112597
Gene: ENSMUSG00000030781
AA Change: Y317F

DomainStartEndE-ValueType
Pfam:SSF 53 490 7e-170 PFAM
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 566 577 N/A INTRINSIC
low complexity region 615 635 N/A INTRINSIC
transmembrane domain 650 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126263
SMART Domains Protein: ENSMUSP00000114673
Gene: ENSMUSG00000030780

DomainStartEndE-ValueType
Pfam:DUF647 61 304 3e-102 PFAM
low complexity region 334 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136345
Predicted Effect probably benign
Transcript: ENSMUST00000137038
SMART Domains Protein: ENSMUSP00000124318
Gene: ENSMUSG00000030781

DomainStartEndE-ValueType
Pfam:SSF 1 103 3.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142841
SMART Domains Protein: ENSMUSP00000115451
Gene: ENSMUSG00000030781

DomainStartEndE-ValueType
Pfam:SSF 53 276 5.7e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147091
Predicted Effect probably benign
Transcript: ENSMUST00000153418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171335
Predicted Effect probably damaging
Transcript: ENSMUST00000205720
AA Change: Y317F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000206716
AA Change: Y100F
Predicted Effect probably benign
Transcript: ENSMUST00000206703
Predicted Effect probably benign
Transcript: ENSMUST00000206909
Meta Mutation Damage Score 0.2685 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium glucose cotransporter family which are sodium-dependent glucose transport proteins. The encoded protein is the major cotransporter involved in glucose reabsorption in the kidney. Mutations in this gene are associated with renal glucosuria. Two transcript variants, one protein-coding and one not, have been found for this gene. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit increased urine glucose, increased eating and drinking behaviors, increased circulating renin activity, decreased urine osmolality, decreased serum aldosterone levels, polyuria, and decreased glucose renal reabsorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik A T 14: 70,157,314 F130L probably benign Het
Aatf C T 11: 84,423,005 R511Q probably benign Het
Acot12 A T 13: 91,784,656 D516V probably benign Het
Adgrb2 T C 4: 130,017,542 V1207A probably damaging Het
Akap9 A G 5: 4,069,185 D3564G probably benign Het
Arl8b C T 6: 108,783,228 probably benign Het
Atf6b T C 17: 34,648,299 probably null Het
Atrn G A 2: 130,986,826 G1097D probably damaging Het
Btbd6 A G 12: 112,977,082 E61G probably damaging Het
Car15 A G 16: 17,835,816 probably benign Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Carmil2 C T 8: 105,691,235 A654V probably damaging Het
Cbwd1 A G 19: 24,949,211 Y159H possibly damaging Het
Ccdc88b A G 19: 6,857,266 L124P probably damaging Het
Ccnd1 A G 7: 144,937,286 probably benign Het
Cd3eap G T 7: 19,359,141 P38Q probably damaging Het
Cenph A G 13: 100,772,741 S53P probably damaging Het
Chrm3 T A 13: 9,877,579 I474F probably damaging Het
Cln8 T A 8: 14,896,769 V261E probably benign Het
Coa6 A G 8: 126,422,760 D25G probably benign Het
Col4a1 T G 8: 11,226,487 probably benign Het
Cpxm1 T C 2: 130,393,135 H588R probably damaging Het
Cul7 T C 17: 46,663,544 L1516P possibly damaging Het
Dcdc5 A G 2: 106,351,564 noncoding transcript Het
Ddx5 T C 11: 106,782,462 probably benign Het
Dhx16 C A 17: 35,881,659 P161Q probably benign Het
Dpy19l1 A T 9: 24,485,110 probably benign Het
Fastkd5 A G 2: 130,615,296 V458A probably damaging Het
Fhit A G 14: 9,870,172 V99A probably damaging Het
Fndc3a A T 14: 72,557,622 probably benign Het
Foxd4 A T 19: 24,899,818 S339R possibly damaging Het
Gm10842 T A 11: 105,147,054 D54E unknown Het
Gns T A 10: 121,376,267 Y94* probably null Het
Gp2 A G 7: 119,454,496 W81R probably benign Het
Hdac5 T G 11: 102,196,096 Q46P probably damaging Het
Homer2 A C 7: 81,649,678 V13G probably damaging Het
Irs3 A G 5: 137,643,839 S446P probably benign Het
Ism2 G T 12: 87,285,339 D141E probably damaging Het
Jak1 T A 4: 101,191,625 M19L probably benign Het
Kcnd3 C A 3: 105,658,759 R419S probably damaging Het
Lamb1 T C 12: 31,282,695 F272S probably damaging Het
Ldlrad2 T G 4: 137,572,268 T82P possibly damaging Het
Lrp2 T C 2: 69,491,931 K1885E probably benign Het
Mbd5 T C 2: 49,257,209 V477A possibly damaging Het
Mrps33 A T 6: 39,805,554 M11K possibly damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myom2 T A 8: 15,069,796 V184E probably damaging Het
Ncor1 C A 11: 62,333,776 G1210V probably damaging Het
Ncor1 C T 11: 62,333,777 G1210R probably damaging Het
Nlrp4a A G 7: 26,457,130 D760G probably benign Het
Noc4l A G 5: 110,651,123 V231A possibly damaging Het
Olfr1056 T C 2: 86,355,663 T240A probably damaging Het
Olfr1217 T C 2: 89,023,826 Y59C probably damaging Het
Olfr1306 A T 2: 111,912,560 Y123* probably null Het
Olfr1450 A G 19: 12,953,702 T38A possibly damaging Het
Olfr193 T A 16: 59,110,225 K128N probably benign Het
Olfr521 T C 7: 99,767,660 I166T probably benign Het
Olfr598 T A 7: 103,328,651 I55N probably damaging Het
Olfr733 A T 14: 50,298,682 V209E probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Patj T A 4: 98,569,110 M1283K probably damaging Het
Pkd1 C T 17: 24,585,683 T790I probably damaging Het
Plod3 C A 5: 136,991,611 T526K probably benign Het
Plxnb2 C A 15: 89,158,613 probably benign Het
Pramel1 T A 4: 143,397,605 D283E possibly damaging Het
Prpf40a T C 2: 53,141,651 probably benign Het
Psg23 A T 7: 18,614,682 Y67N probably damaging Het
Rftn1 T A 17: 49,994,261 Q242L possibly damaging Het
Rp1l1 A T 14: 64,032,066 E1700D probably benign Het
Scube3 T C 17: 28,164,153 F435S probably damaging Het
Sdk2 T C 11: 113,781,010 Y2104C probably damaging Het
Sept11 A G 5: 93,165,368 E358G possibly damaging Het
Sh3bp1 T C 15: 78,905,775 L246P probably damaging Het
Sis T C 3: 72,951,642 Y352C probably damaging Het
Skint1 T C 4: 112,021,365 S165P probably damaging Het
Skint10 C T 4: 112,728,811 probably benign Het
Slc1a2 A T 2: 102,756,072 R340S probably damaging Het
Slc26a3 C A 12: 31,447,740 Q48K probably benign Het
Sorbs3 T A 14: 70,193,926 T262S probably benign Het
Tas2r118 G T 6: 23,969,401 S220R probably damaging Het
Terf2ip C A 8: 112,015,342 Q223K possibly damaging Het
Tespa1 A G 10: 130,360,811 Q206R probably damaging Het
Tex10 T C 4: 48,462,766 probably null Het
Tle1 T A 4: 72,124,990 K547N probably damaging Het
Tmem131l T A 3: 83,898,546 Q1530L probably damaging Het
Tomm20l A G 12: 71,123,077 E145G possibly damaging Het
Tra2a C T 6: 49,250,951 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trim37 T A 11: 87,145,502 Y121* probably null Het
Tube1 C T 10: 39,140,945 probably null Het
Usp6nl T A 2: 6,421,009 V187D probably damaging Het
Vmn1r13 T C 6: 57,210,263 F136L probably benign Het
Vmn1r201 A T 13: 22,475,146 I177F probably benign Het
Vmn1r203 A T 13: 22,524,273 T75S possibly damaging Het
Vmn1r225 C T 17: 20,502,456 S53L probably benign Het
Xab2 A T 8: 3,610,994 W707R probably damaging Het
Zfp808 T C 13: 62,169,434 probably benign Het
Other mutations in Slc5a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Slc5a2 APN 7 128270622 missense probably benign 0.07
IGL03084:Slc5a2 APN 7 128266604 missense probably benign 0.25
dregs UTSW 7 128267505 splice site probably null
jimbee UTSW 7 large deletion
R0026:Slc5a2 UTSW 7 128270053 missense probably damaging 1.00
R0395:Slc5a2 UTSW 7 128267482 missense probably damaging 1.00
R0762:Slc5a2 UTSW 7 128267482 missense probably damaging 1.00
R0966:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R0968:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1382:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1383:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1385:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1467:Slc5a2 UTSW 7 128271256 unclassified probably benign
R4836:Slc5a2 UTSW 7 128267505 splice site probably null
R4983:Slc5a2 UTSW 7 128271810 makesense probably null
R5703:Slc5a2 UTSW 7 128270615 missense possibly damaging 0.77
R6185:Slc5a2 UTSW 7 128271177 missense probably damaging 0.98
R6696:Slc5a2 UTSW 7 128270043 missense probably damaging 1.00
R6969:Slc5a2 UTSW 7 128272077 missense probably benign 0.00
R7062:Slc5a2 UTSW 7 128270040 missense probably damaging 0.99
R7576:Slc5a2 UTSW 7 128265805 missense probably damaging 1.00
R7747:Slc5a2 UTSW 7 128266395 splice site probably null
R7802:Slc5a2 UTSW 7 128271798 missense possibly damaging 0.80
R7915:Slc5a2 UTSW 7 128265794 missense probably damaging 0.96
R8027:Slc5a2 UTSW 7 128270546 missense probably damaging 1.00
R8194:Slc5a2 UTSW 7 128271156 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TCCCCTTATCCCATGTGAGTTACAGG -3'
(R):5'- TAGTGTGAACGGCGAATCAGGTCC -3'

Sequencing Primer
(F):5'- ATCTGGATGCCCCTTATCCCAT -3'
(R):5'- GTAGAGAATGCGGCTGATCA -3'
Posted On2013-06-11