Mutagenetix > Incidental Mutations

Incidental Mutation 'R5779:Smg5'

446865

Institutional Source

Beutler Lab

Gene Symbol

Smg5

Ensembl Gene

ENSMUSG00000001415

Gene Name

Smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)

Synonyms

MMRRC Submission

043377-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5779 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88336260-88362338 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 88351618 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001451]

AlphaFold

Q6ZPY2

Predicted Effect

probably benign
Transcript: ENSMUST00000001451

SMART Domains

Protein: ENSMUSP00000001451
Gene: ENSMUSG00000001415

Domain	Start	End	E-Value	Type
low complexity region	4	14	N/A	INTRINSIC
Pfam:EST1	77	189	1.1e-26	PFAM
Pfam:EST1_DNA_bind	197	427	4.6e-53	PFAM
low complexity region	447	468	N/A	INTRINSIC
low complexity region	481	501	N/A	INTRINSIC
Pfam:EST1_DNA_bind	611	745	3.7e-9	PFAM
coiled coil region	801	842	N/A	INTRINSIC
PINc	856	979	3.23e-15	SMART
low complexity region	990	999	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192009

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192057

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193007

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193097

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

88% (52/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMG5 is involved in nonsense-mediated mRNA decay (Ohnishi et al., 2003 [PubMed 14636577]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	T	17: 56,881,061	N190Y	probably benign	Het
2310035C23Rik	T	G	1: 105,687,347	N246K	probably damaging	Het
Abca6	T	C	11: 110,184,670	M1332V	probably benign	Het
Afg3l2	T	C	18: 67,440,443	K132R	probably null	Het
Arap3	T	C	18: 37,984,365	D886G	probably damaging	Het
B3gntl1	G	T	11: 121,651,676		probably null	Het
Cdk12	T	A	11: 98,219,074	S640R	probably benign	Het
Ceacam12	C	A	7: 18,069,154	P162T	probably benign	Het
Chrna5	C	A	9: 54,998,104	H67N	probably benign	Het
Copb1	T	A	7: 114,219,572	D837V	probably damaging	Het
D11Wsu47e	A	G	11: 113,687,992	D71G	probably benign	Het
Dcaf5	C	T	12: 80,338,832	R840H	probably benign	Het
Ect2l	T	A	10: 18,163,438	Q324L	probably benign	Het
Eef1e1	T	C	13: 38,646,273	N141S	probably damaging	Het
Eif2ak4	A	C	2: 118,412,963	N208T	possibly damaging	Het
Ext1	A	G	15: 53,344,553	Y271H	probably damaging	Het
Fam173a	A	G	17: 25,790,657	V194A	probably benign	Het
Fbxo5	G	A	10: 5,800,303	R323C	possibly damaging	Het
Fpr-rs3	C	A	17: 20,624,226	A218S	possibly damaging	Het
Gm20499	G	A	5: 114,817,021		probably benign	Het
Gucy1b2	C	A	14: 62,414,301	L400F	possibly damaging	Het
Hgd	T	A	16: 37,593,371	L24H	probably benign	Het
Hmx3	C	A	7: 131,544,328	S255*	probably null	Het
Ifrd1	A	T	12: 40,203,370	F448I	probably damaging	Het
Igfn1	T	A	1: 135,966,840	E1996V	probably benign	Het
Itpr1	G	A	6: 108,352,143	G173R	probably damaging	Het
Kbtbd8	T	C	6: 95,118,534	S26P	probably benign	Het
Kctd17	A	T	15: 78,437,133		probably benign	Het
Matr3	T	C	18: 35,584,522	S258P	possibly damaging	Het
Mpp4	G	A	1: 59,151,666	A90V	probably benign	Het
Mrpl20	G	A	4: 155,806,921	R34Q	probably damaging	Het
Neb	A	T	2: 52,245,301	S3266T	probably damaging	Het
Nipal3	A	G	4: 135,452,339		probably benign	Het
Npas2	A	T	1: 39,287,571	T46S	possibly damaging	Het
Nsd3	G	T	8: 25,682,669	E815*	probably null	Het
Nup98	C	A	7: 102,152,361	V786L	probably benign	Het
Olfr730	A	T	14: 50,186,746	M157K	possibly damaging	Het
Pcdhb3	T	C	18: 37,301,467	V162A	probably benign	Het
Pcgf2	G	A	11: 97,690,291	P58L	probably damaging	Het
Penk	A	G	4: 4,134,318	F110L	probably damaging	Het
Scfd1	A	G	12: 51,431,529	N508S	probably benign	Het
Scn2a	T	C	2: 65,764,483	V1892A	probably benign	Het
Sema6a	G	A	18: 47,248,826	R885C	probably damaging	Het
Sik2	T	C	9: 50,895,845	H755R	probably benign	Het
Slc36a3	A	T	11: 55,135,268	Y241*	probably null	Het
Spag9	A	G	11: 94,114,253	T1049A	probably benign	Het
Tas2r103	T	C	6: 133,036,945	M53V	probably benign	Het
Tpr	C	T	1: 150,423,541	A1090V	probably damaging	Het
Traf5	T	A	1: 191,997,672	R473W	probably damaging	Het
Ush2a	T	C	1: 188,443,510		probably null	Het
Vit	A	G	17: 78,546,426	T34A	probably benign	Het

Other mutations in Smg5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Smg5	APN	3	88351428	nonsense	probably null
IGL00902:Smg5	APN	3	88353085	missense	probably benign	0.00
IGL00990:Smg5	APN	3	88343038	critical splice donor site	probably null
IGL01371:Smg5	APN	3	88359644	unclassified	probably benign
IGL01536:Smg5	APN	3	88349245	missense	possibly damaging	0.58
IGL02215:Smg5	APN	3	88352998	missense	possibly damaging	0.47
IGL03366:Smg5	APN	3	88346452	nonsense	probably null
R0013:Smg5	UTSW	3	88349233	missense	probably benign	0.00
R0017:Smg5	UTSW	3	88351105	missense	probably damaging	1.00
R0017:Smg5	UTSW	3	88351105	missense	probably damaging	1.00
R0129:Smg5	UTSW	3	88349233	missense	probably benign	0.00
R0153:Smg5	UTSW	3	88353872	unclassified	probably benign
R1386:Smg5	UTSW	3	88355671	missense	probably damaging	1.00
R1941:Smg5	UTSW	3	88345380	missense	possibly damaging	0.71
R2185:Smg5	UTSW	3	88351561	missense	probably benign
R2282:Smg5	UTSW	3	88345398	missense	probably benign	0.02
R3615:Smg5	UTSW	3	88336451	missense	possibly damaging	0.94
R3616:Smg5	UTSW	3	88336451	missense	possibly damaging	0.94
R4008:Smg5	UTSW	3	88349158	missense	probably benign	0.01
R4687:Smg5	UTSW	3	88342469	missense	possibly damaging	0.83
R4726:Smg5	UTSW	3	88336451	missense	possibly damaging	0.94
R4801:Smg5	UTSW	3	88355692	nonsense	probably null
R4802:Smg5	UTSW	3	88355692	nonsense	probably null
R4977:Smg5	UTSW	3	88355725	nonsense	probably null
R5384:Smg5	UTSW	3	88351293	missense	probably damaging	1.00
R5443:Smg5	UTSW	3	88354589	missense	probably damaging	0.99
R5860:Smg5	UTSW	3	88342907	missense	probably damaging	0.97
R6080:Smg5	UTSW	3	88351509	missense	probably benign
R6263:Smg5	UTSW	3	88341901	missense	possibly damaging	0.90
R6431:Smg5	UTSW	3	88351220	missense	probably benign	0.00
R6722:Smg5	UTSW	3	88353025	missense	probably damaging	0.99
R6847:Smg5	UTSW	3	88342552	missense	probably damaging	1.00
R6950:Smg5	UTSW	3	88349269	critical splice donor site	probably null
R7091:Smg5	UTSW	3	88351347	missense	probably benign	0.00
R7395:Smg5	UTSW	3	88361071	missense	probably damaging	0.99
R7678:Smg5	UTSW	3	88353895	missense	possibly damaging	0.93
R7796:Smg5	UTSW	3	88349432	missense	probably damaging	0.96
R8209:Smg5	UTSW	3	88351531	missense	probably benign	0.00
R8327:Smg5	UTSW	3	88345407	missense	probably damaging	1.00
R8987:Smg5	UTSW	3	88360407	critical splice donor site	probably null
R9345:Smg5	UTSW	3	88354541	missense	probably damaging	1.00
Z1177:Smg5	UTSW	3	88351134	missense	probably damaging	1.00
Z1177:Smg5	UTSW	3	88352990	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- TGTCCACCCAGATGTTCCAG -3'
(R):5'- TGTTACAGGAACATTATGCCCAGC -3'

Sequencing Primer
(F):5'- ATGTTCCAGACCAAGCGCTG -3'
(R):5'- AGGAACATTATGCCCAGCTTCTG -3'

Posted On

2016-12-15