Incidental Mutation 'R5779:Kbtbd8'
ID446871
Institutional Source Beutler Lab
Gene Symbol Kbtbd8
Ensembl Gene ENSMUSG00000030031
Gene Namekelch repeat and BTB (POZ) domain containing 8
SynonymsSSEC 51, SSEC51, Takrp, SSEC-51
MMRRC Submission 043377-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock #R5779 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location95117240-95129790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95118534 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 26 (S26P)
Ref Sequence ENSEMBL: ENSMUSP00000145009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032107] [ENSMUST00000119582] [ENSMUST00000122938]
Predicted Effect probably benign
Transcript: ENSMUST00000032107
AA Change: S10P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032107
Gene: ENSMUSG00000030031
AA Change: S10P

DomainStartEndE-ValueType
BTB 49 147 7.37e-28 SMART
BACK 152 254 1.37e-26 SMART
Kelch 334 388 2.63e-3 SMART
Kelch 389 439 6.13e-4 SMART
Kelch 480 530 5.06e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119582
SMART Domains Protein: ENSMUSP00000113739
Gene: ENSMUSG00000030031

DomainStartEndE-ValueType
Pfam:BTB 1 70 5.1e-14 PFAM
BACK 75 177 1.37e-26 SMART
Kelch 257 311 2.63e-3 SMART
Kelch 312 362 6.13e-4 SMART
Blast:Kelch 364 402 4e-18 BLAST
Kelch 403 453 5.06e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122938
AA Change: S26P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145009
Gene: ENSMUSG00000030031
AA Change: S26P

DomainStartEndE-ValueType
BTB 65 142 1.4e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145387
Meta Mutation Damage Score 0.0697 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 88% (52/59)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,881,061 N190Y probably benign Het
2310035C23Rik T G 1: 105,687,347 N246K probably damaging Het
Abca6 T C 11: 110,184,670 M1332V probably benign Het
Afg3l2 T C 18: 67,440,443 K132R probably null Het
Arap3 T C 18: 37,984,365 D886G probably damaging Het
B3gntl1 G T 11: 121,651,676 probably null Het
Cdk12 T A 11: 98,219,074 S640R probably benign Het
Ceacam12 C A 7: 18,069,154 P162T probably benign Het
Chrna5 C A 9: 54,998,104 H67N probably benign Het
Copb1 T A 7: 114,219,572 D837V probably damaging Het
D11Wsu47e A G 11: 113,687,992 D71G probably benign Het
Dcaf5 C T 12: 80,338,832 R840H probably benign Het
Ect2l T A 10: 18,163,438 Q324L probably benign Het
Eef1e1 T C 13: 38,646,273 N141S probably damaging Het
Eif2ak4 A C 2: 118,412,963 N208T possibly damaging Het
Ext1 A G 15: 53,344,553 Y271H probably damaging Het
Fam173a A G 17: 25,790,657 V194A probably benign Het
Fbxo5 G A 10: 5,800,303 R323C possibly damaging Het
Fpr-rs3 C A 17: 20,624,226 A218S possibly damaging Het
Gm20499 G A 5: 114,817,021 probably benign Het
Gucy1b2 C A 14: 62,414,301 L400F possibly damaging Het
Hgd T A 16: 37,593,371 L24H probably benign Het
Hmx3 C A 7: 131,544,328 S255* probably null Het
Ifrd1 A T 12: 40,203,370 F448I probably damaging Het
Igfn1 T A 1: 135,966,840 E1996V probably benign Het
Itpr1 G A 6: 108,352,143 G173R probably damaging Het
Kctd17 A T 15: 78,437,133 probably benign Het
Matr3 T C 18: 35,584,522 S258P possibly damaging Het
Mpp4 G A 1: 59,151,666 A90V probably benign Het
Mrpl20 G A 4: 155,806,921 R34Q probably damaging Het
Neb A T 2: 52,245,301 S3266T probably damaging Het
Nipal3 A G 4: 135,452,339 probably benign Het
Npas2 A T 1: 39,287,571 T46S possibly damaging Het
Nsd3 G T 8: 25,682,669 E815* probably null Het
Nup98 C A 7: 102,152,361 V786L probably benign Het
Olfr730 A T 14: 50,186,746 M157K possibly damaging Het
Pcdhb3 T C 18: 37,301,467 V162A probably benign Het
Pcgf2 G A 11: 97,690,291 P58L probably damaging Het
Penk A G 4: 4,134,318 F110L probably damaging Het
Scfd1 A G 12: 51,431,529 N508S probably benign Het
Scn2a T C 2: 65,764,483 V1892A probably benign Het
Sema6a G A 18: 47,248,826 R885C probably damaging Het
Sik2 T C 9: 50,895,845 H755R probably benign Het
Slc36a3 A T 11: 55,135,268 Y241* probably null Het
Smg5 T C 3: 88,351,618 probably benign Het
Spag9 A G 11: 94,114,253 T1049A probably benign Het
Tas2r103 T C 6: 133,036,945 M53V probably benign Het
Tpr C T 1: 150,423,541 A1090V probably damaging Het
Traf5 T A 1: 191,997,672 R473W probably damaging Het
Ush2a T C 1: 188,443,510 probably null Het
Vit A G 17: 78,546,426 T34A probably benign Het
Other mutations in Kbtbd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Kbtbd8 APN 6 95126513 missense probably damaging 1.00
IGL01382:Kbtbd8 APN 6 95122230 missense probably damaging 1.00
IGL01459:Kbtbd8 APN 6 95122808 missense probably benign 0.10
IGL01656:Kbtbd8 APN 6 95118676 missense probably benign 0.02
IGL02100:Kbtbd8 APN 6 95122682 missense probably damaging 1.00
IGL02133:Kbtbd8 APN 6 95121732 splice site probably benign
IGL02532:Kbtbd8 APN 6 95126536 missense probably benign 0.17
IGL02982:Kbtbd8 APN 6 95126566 missense probably benign 0.01
IGL03074:Kbtbd8 APN 6 95122352 missense probably damaging 0.99
R0782:Kbtbd8 UTSW 6 95122232 missense probably damaging 1.00
R2075:Kbtbd8 UTSW 6 95126683 missense possibly damaging 0.47
R2329:Kbtbd8 UTSW 6 95126780 missense probably benign 0.00
R2698:Kbtbd8 UTSW 6 95126589 nonsense probably null
R3906:Kbtbd8 UTSW 6 95126584 missense probably damaging 1.00
R4276:Kbtbd8 UTSW 6 95126933 missense probably damaging 0.99
R4915:Kbtbd8 UTSW 6 95126534 missense possibly damaging 0.95
R5141:Kbtbd8 UTSW 6 95121839 missense probably damaging 1.00
R5294:Kbtbd8 UTSW 6 95121832 nonsense probably null
R6645:Kbtbd8 UTSW 6 95126749 nonsense probably null
R7073:Kbtbd8 UTSW 6 95121833 missense probably damaging 1.00
R7161:Kbtbd8 UTSW 6 95126696 missense probably benign 0.30
R7600:Kbtbd8 UTSW 6 95122592 missense probably damaging 1.00
R7731:Kbtbd8 UTSW 6 95118578 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAACTTGTTCGCCCTTGTTGAG -3'
(R):5'- CACTGGGTTGAAAGGGAGTC -3'

Sequencing Primer
(F):5'- GCCCTTGTTGAGCTCTCGG -3'
(R):5'- TACCGTCGTCATACCTGAAGTAG -3'
Posted On2016-12-15