Incidental Mutation 'R5779:Sik2'
ID446879
Institutional Source Beutler Lab
Gene Symbol Sik2
Ensembl Gene ENSMUSG00000037112
Gene Namesalt inducible kinase 2
SynonymsSnf1lk2
MMRRC Submission 043377-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.786) question?
Stock #R5779 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location50892801-51009073 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50895845 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 755 (H755R)
Ref Sequence ENSEMBL: ENSMUSP00000134936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034560] [ENSMUST00000041375] [ENSMUST00000174628] [ENSMUST00000176349] [ENSMUST00000176491] [ENSMUST00000176663] [ENSMUST00000176798] [ENSMUST00000176824]
Predicted Effect probably benign
Transcript: ENSMUST00000034560
SMART Domains Protein: ENSMUSP00000034560
Gene: ENSMUSG00000032058

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 2.2e-6 PFAM
Pfam:HEAT_EZ 182 243 9.9e-6 PFAM
Pfam:HEAT 295 325 5.9e-6 PFAM
Pfam:HEAT_2 378 479 1.1e-10 PFAM
Pfam:HEAT_2 495 596 5.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041375
AA Change: H755R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038761
Gene: ENSMUSG00000037112
AA Change: H755R

DomainStartEndE-ValueType
S_TKc 20 271 4.63e-101 SMART
low complexity region 454 464 N/A INTRINSIC
low complexity region 643 664 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
low complexity region 800 842 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174628
SMART Domains Protein: ENSMUSP00000133404
Gene: ENSMUSG00000032058

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 4.6e-6 PFAM
Pfam:HEAT 217 247 4.5e-5 PFAM
Pfam:HEAT 295 325 4.3e-6 PFAM
Pfam:HEAT_2 378 479 1.7e-11 PFAM
low complexity region 643 655 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176349
SMART Domains Protein: ENSMUSP00000135758
Gene: ENSMUSG00000032058

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 114 144 2e-6 PFAM
Pfam:HEAT_EZ 116 179 8.7e-6 PFAM
Pfam:HEAT 153 183 5.5e-5 PFAM
Pfam:HEAT 231 261 5.3e-6 PFAM
Pfam:HEAT_2 314 415 9.3e-11 PFAM
Pfam:HEAT_2 430 532 4.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176491
AA Change: H755R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134954
Gene: ENSMUSG00000037112
AA Change: H755R

DomainStartEndE-ValueType
S_TKc 20 271 4.63e-101 SMART
low complexity region 454 464 N/A INTRINSIC
low complexity region 643 664 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
low complexity region 800 842 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176663
AA Change: H755R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135376
Gene: ENSMUSG00000037112
AA Change: H755R

DomainStartEndE-ValueType
S_TKc 20 271 4.63e-101 SMART
low complexity region 454 464 N/A INTRINSIC
low complexity region 643 664 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
low complexity region 800 842 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176798
SMART Domains Protein: ENSMUSP00000135525
Gene: ENSMUSG00000032058

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 2.3e-6 PFAM
Pfam:HEAT_EZ 182 243 1e-5 PFAM
Pfam:HEAT 295 325 6e-6 PFAM
Pfam:HEAT_2 378 479 1.1e-10 PFAM
Pfam:HEAT_2 495 596 5.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176824
AA Change: H755R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134936
Gene: ENSMUSG00000037112
AA Change: H755R

DomainStartEndE-ValueType
S_TKc 20 271 4.63e-101 SMART
low complexity region 454 464 N/A INTRINSIC
low complexity region 643 664 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
low complexity region 800 842 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 88% (52/59)
MGI Phenotype PHENOTYPE: Mice heterozygous for a knock-out allele exhibit darkened hair color in an agouti background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,881,061 N190Y probably benign Het
2310035C23Rik T G 1: 105,687,347 N246K probably damaging Het
Abca6 T C 11: 110,184,670 M1332V probably benign Het
Afg3l2 T C 18: 67,440,443 K132R probably null Het
Arap3 T C 18: 37,984,365 D886G probably damaging Het
B3gntl1 G T 11: 121,651,676 probably null Het
Cdk12 T A 11: 98,219,074 S640R probably benign Het
Ceacam12 C A 7: 18,069,154 P162T probably benign Het
Chrna5 C A 9: 54,998,104 H67N probably benign Het
Copb1 T A 7: 114,219,572 D837V probably damaging Het
D11Wsu47e A G 11: 113,687,992 D71G probably benign Het
Dcaf5 C T 12: 80,338,832 R840H probably benign Het
Ect2l T A 10: 18,163,438 Q324L probably benign Het
Eef1e1 T C 13: 38,646,273 N141S probably damaging Het
Eif2ak4 A C 2: 118,412,963 N208T possibly damaging Het
Ext1 A G 15: 53,344,553 Y271H probably damaging Het
Fam173a A G 17: 25,790,657 V194A probably benign Het
Fbxo5 G A 10: 5,800,303 R323C possibly damaging Het
Fpr-rs3 C A 17: 20,624,226 A218S possibly damaging Het
Gm20499 G A 5: 114,817,021 probably benign Het
Gucy1b2 C A 14: 62,414,301 L400F possibly damaging Het
Hgd T A 16: 37,593,371 L24H probably benign Het
Hmx3 C A 7: 131,544,328 S255* probably null Het
Ifrd1 A T 12: 40,203,370 F448I probably damaging Het
Igfn1 T A 1: 135,966,840 E1996V probably benign Het
Itpr1 G A 6: 108,352,143 G173R probably damaging Het
Kbtbd8 T C 6: 95,118,534 S26P probably benign Het
Kctd17 A T 15: 78,437,133 probably benign Het
Matr3 T C 18: 35,584,522 S258P possibly damaging Het
Mpp4 G A 1: 59,151,666 A90V probably benign Het
Mrpl20 G A 4: 155,806,921 R34Q probably damaging Het
Neb A T 2: 52,245,301 S3266T probably damaging Het
Nipal3 A G 4: 135,452,339 probably benign Het
Npas2 A T 1: 39,287,571 T46S possibly damaging Het
Nsd3 G T 8: 25,682,669 E815* probably null Het
Nup98 C A 7: 102,152,361 V786L probably benign Het
Olfr730 A T 14: 50,186,746 M157K possibly damaging Het
Pcdhb3 T C 18: 37,301,467 V162A probably benign Het
Pcgf2 G A 11: 97,690,291 P58L probably damaging Het
Penk A G 4: 4,134,318 F110L probably damaging Het
Scfd1 A G 12: 51,431,529 N508S probably benign Het
Scn2a T C 2: 65,764,483 V1892A probably benign Het
Sema6a G A 18: 47,248,826 R885C probably damaging Het
Slc36a3 A T 11: 55,135,268 Y241* probably null Het
Smg5 T C 3: 88,351,618 probably benign Het
Spag9 A G 11: 94,114,253 T1049A probably benign Het
Tas2r103 T C 6: 133,036,945 M53V probably benign Het
Tpr C T 1: 150,423,541 A1090V probably damaging Het
Traf5 T A 1: 191,997,672 R473W probably damaging Het
Ush2a T C 1: 188,443,510 probably null Het
Vit A G 17: 78,546,426 T34A probably benign Het
Other mutations in Sik2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Sik2 APN 9 50907463 missense probably damaging 0.96
IGL01552:Sik2 APN 9 50917522 splice site probably benign
IGL02175:Sik2 APN 9 50895609 nonsense probably null
IGL02355:Sik2 APN 9 50917603 nonsense probably null
IGL02362:Sik2 APN 9 50917603 nonsense probably null
IGL03197:Sik2 APN 9 50895773 missense probably damaging 1.00
R0066:Sik2 UTSW 9 50998533 missense probably benign 0.18
R0066:Sik2 UTSW 9 50998533 missense probably benign 0.18
R0109:Sik2 UTSW 9 50899475 missense possibly damaging 0.50
R0109:Sik2 UTSW 9 50899475 missense possibly damaging 0.50
R0416:Sik2 UTSW 9 50995632 missense probably damaging 1.00
R0648:Sik2 UTSW 9 50898745 missense probably benign 0.26
R0714:Sik2 UTSW 9 50907436 missense probably benign 0.13
R1472:Sik2 UTSW 9 51008811 missense probably damaging 1.00
R1592:Sik2 UTSW 9 50995671 missense probably damaging 1.00
R1899:Sik2 UTSW 9 50995674 splice site probably benign
R2032:Sik2 UTSW 9 50995647 missense probably damaging 1.00
R2079:Sik2 UTSW 9 50907406 critical splice donor site probably null
R2853:Sik2 UTSW 9 50898297 missense probably damaging 1.00
R4085:Sik2 UTSW 9 50935385 intron probably benign
R4567:Sik2 UTSW 9 50998576 missense probably damaging 1.00
R5098:Sik2 UTSW 9 50995591 intron probably benign
R5176:Sik2 UTSW 9 50899403 missense probably benign 0.02
R5640:Sik2 UTSW 9 50915506 missense possibly damaging 0.93
R5682:Sik2 UTSW 9 50917082 missense probably damaging 1.00
R5935:Sik2 UTSW 9 50917131 missense probably damaging 1.00
R5997:Sik2 UTSW 9 50895342 critical splice donor site probably null
R6664:Sik2 UTSW 9 50935457 missense probably damaging 1.00
R6787:Sik2 UTSW 9 50998534 missense possibly damaging 0.67
R6980:Sik2 UTSW 9 50897455 missense probably benign 0.00
R7057:Sik2 UTSW 9 50998561 missense probably damaging 1.00
R7064:Sik2 UTSW 9 50907420 missense probably damaging 0.99
R7165:Sik2 UTSW 9 50917097 missense probably damaging 1.00
R7892:Sik2 UTSW 9 51008832 missense probably damaging 0.98
R7975:Sik2 UTSW 9 51008832 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAAGGAGGTTGGAGCAGCTC -3'
(R):5'- TAGGAAACTGGAGTTCATGCC -3'

Sequencing Primer
(F):5'- GCTGCAATTGTGAGGGTAAG -3'
(R):5'- AAACTGGAGTTCATGCCTGGTATTG -3'
Posted On2016-12-15