Incidental Mutation 'R5779:Chrna5'
ID446880
Institutional Source Beutler Lab
Gene Symbol Chrna5
Ensembl Gene ENSMUSG00000035594
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 5
SynonymsAcra-5, Acra5
MMRRC Submission 043377-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R5779 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location54980880-55007779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 54998104 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 67 (H67N)
Ref Sequence ENSEMBL: ENSMUSP00000150942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093844] [ENSMUST00000213960] [ENSMUST00000217408]
Predicted Effect probably benign
Transcript: ENSMUST00000093844
AA Change: H38N

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000091365
Gene: ENSMUSG00000035594
AA Change: H38N

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 18 221 4.9e-72 PFAM
Pfam:Neur_chan_memb 228 352 1.9e-51 PFAM
Pfam:Neur_chan_memb 338 417 1.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213960
AA Change: H67N

PolyPhen 2 Score 0.354 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216865
Predicted Effect probably benign
Transcript: ENSMUST00000217408
Meta Mutation Damage Score 0.0753 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 88% (52/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nicotinic acetylcholine receptor subunit and a member of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. These receptors are thought to be heteropentamers composed of separate but similar subunits. Defects in this gene have been linked to susceptibility to lung cancer type 2 (LNCR2).[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are less sensitive to nicotine-induced seizures than wild-type controls and exhibit a significantly shorter latency time to seizure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,881,061 N190Y probably benign Het
2310035C23Rik T G 1: 105,687,347 N246K probably damaging Het
Abca6 T C 11: 110,184,670 M1332V probably benign Het
Afg3l2 T C 18: 67,440,443 K132R probably null Het
Arap3 T C 18: 37,984,365 D886G probably damaging Het
B3gntl1 G T 11: 121,651,676 probably null Het
Cdk12 T A 11: 98,219,074 S640R probably benign Het
Ceacam12 C A 7: 18,069,154 P162T probably benign Het
Copb1 T A 7: 114,219,572 D837V probably damaging Het
D11Wsu47e A G 11: 113,687,992 D71G probably benign Het
Dcaf5 C T 12: 80,338,832 R840H probably benign Het
Ect2l T A 10: 18,163,438 Q324L probably benign Het
Eef1e1 T C 13: 38,646,273 N141S probably damaging Het
Eif2ak4 A C 2: 118,412,963 N208T possibly damaging Het
Ext1 A G 15: 53,344,553 Y271H probably damaging Het
Fam173a A G 17: 25,790,657 V194A probably benign Het
Fbxo5 G A 10: 5,800,303 R323C possibly damaging Het
Fpr-rs3 C A 17: 20,624,226 A218S possibly damaging Het
Gm20499 G A 5: 114,817,021 probably benign Het
Gucy1b2 C A 14: 62,414,301 L400F possibly damaging Het
Hgd T A 16: 37,593,371 L24H probably benign Het
Hmx3 C A 7: 131,544,328 S255* probably null Het
Ifrd1 A T 12: 40,203,370 F448I probably damaging Het
Igfn1 T A 1: 135,966,840 E1996V probably benign Het
Itpr1 G A 6: 108,352,143 G173R probably damaging Het
Kbtbd8 T C 6: 95,118,534 S26P probably benign Het
Kctd17 A T 15: 78,437,133 probably benign Het
Matr3 T C 18: 35,584,522 S258P possibly damaging Het
Mpp4 G A 1: 59,151,666 A90V probably benign Het
Mrpl20 G A 4: 155,806,921 R34Q probably damaging Het
Neb A T 2: 52,245,301 S3266T probably damaging Het
Nipal3 A G 4: 135,452,339 probably benign Het
Npas2 A T 1: 39,287,571 T46S possibly damaging Het
Nsd3 G T 8: 25,682,669 E815* probably null Het
Nup98 C A 7: 102,152,361 V786L probably benign Het
Olfr730 A T 14: 50,186,746 M157K possibly damaging Het
Pcdhb3 T C 18: 37,301,467 V162A probably benign Het
Pcgf2 G A 11: 97,690,291 P58L probably damaging Het
Penk A G 4: 4,134,318 F110L probably damaging Het
Scfd1 A G 12: 51,431,529 N508S probably benign Het
Scn2a T C 2: 65,764,483 V1892A probably benign Het
Sema6a G A 18: 47,248,826 R885C probably damaging Het
Sik2 T C 9: 50,895,845 H755R probably benign Het
Slc36a3 A T 11: 55,135,268 Y241* probably null Het
Smg5 T C 3: 88,351,618 probably benign Het
Spag9 A G 11: 94,114,253 T1049A probably benign Het
Tas2r103 T C 6: 133,036,945 M53V probably benign Het
Tpr C T 1: 150,423,541 A1090V probably damaging Het
Traf5 T A 1: 191,997,672 R473W probably damaging Het
Ush2a T C 1: 188,443,510 probably null Het
Vit A G 17: 78,546,426 T34A probably benign Het
Other mutations in Chrna5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Chrna5 APN 9 55004399 missense possibly damaging 0.61
IGL01503:Chrna5 APN 9 54998171 intron probably benign
IGL01617:Chrna5 APN 9 55005013 missense probably damaging 0.98
IGL01935:Chrna5 APN 9 55004843 missense probably benign 0.01
IGL02613:Chrna5 APN 9 55006421 missense probably damaging 0.99
IGL03248:Chrna5 APN 9 55004639 missense probably damaging 1.00
IGL03412:Chrna5 APN 9 55004435 missense probably damaging 1.00
R0712:Chrna5 UTSW 9 55004363 missense probably damaging 1.00
R1619:Chrna5 UTSW 9 55004365 missense probably benign 0.00
R1698:Chrna5 UTSW 9 55004642 missense probably damaging 1.00
R1789:Chrna5 UTSW 9 55004651 missense possibly damaging 0.94
R1800:Chrna5 UTSW 9 55004875 missense probably damaging 0.99
R4028:Chrna5 UTSW 9 54998086 missense probably damaging 1.00
R4030:Chrna5 UTSW 9 54998086 missense probably damaging 1.00
R4031:Chrna5 UTSW 9 54998086 missense probably damaging 1.00
R4201:Chrna5 UTSW 9 54998075 missense probably benign 0.00
R4792:Chrna5 UTSW 9 55004701 missense probably damaging 1.00
R5196:Chrna5 UTSW 9 55006519 missense possibly damaging 0.91
R5718:Chrna5 UTSW 9 54998105 missense probably benign 0.00
R6254:Chrna5 UTSW 9 55006456 missense probably benign 0.00
R6492:Chrna5 UTSW 9 54998063 missense probably benign 0.11
R6887:Chrna5 UTSW 9 55005133 missense probably benign 0.00
R6986:Chrna5 UTSW 9 55006457 missense possibly damaging 0.83
R7056:Chrna5 UTSW 9 54981701 intron probably benign
R7222:Chrna5 UTSW 9 54998063 missense probably benign 0.11
R7384:Chrna5 UTSW 9 55004833 missense probably damaging 1.00
R7572:Chrna5 UTSW 9 55006465 missense probably damaging 1.00
R7653:Chrna5 UTSW 9 55002434 missense probably benign
R7846:Chrna5 UTSW 9 55005107 missense probably benign 0.38
R7929:Chrna5 UTSW 9 55005107 missense probably benign 0.38
Z1176:Chrna5 UTSW 9 55004482 missense probably damaging 1.00
Z1177:Chrna5 UTSW 9 55004956 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GGGCCAGCCAATTTCAAAC -3'
(R):5'- GGCTGCATTTGGTCACTCTG -3'

Sequencing Primer
(F):5'- ACTTGTTATGCAGGGTTGC -3'
(R):5'- ACTCTGGCAACCTCTAGTGG -3'
Posted On2016-12-15