Incidental Mutation 'R5779:Ect2l'
ID446882
Institutional Source Beutler Lab
Gene Symbol Ect2l
Ensembl Gene ENSMUSG00000071392
Gene Nameepithelial cell transforming sequence 2 oncogene-like
SynonymsC330021H03Rik, Gm10331
MMRRC Submission 043377-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5779 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location18128903-18210890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18163438 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 324 (Q324L)
Ref Sequence ENSEMBL: ENSMUSP00000147170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095817] [ENSMUST00000207827] [ENSMUST00000208948] [ENSMUST00000209178]
Predicted Effect probably benign
Transcript: ENSMUST00000095817
AA Change: Q416L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000093497
Gene: ENSMUSG00000071392
AA Change: Q416L

DomainStartEndE-ValueType
FBOX 93 133 3.5e-4 SMART
Pfam:DUF4347 297 468 1.4e-11 PFAM
RhoGEF 578 761 6.3e-46 SMART
Blast:PH 793 909 6e-49 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000207827
AA Change: Q416L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000208948
AA Change: Q416L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000209178
AA Change: Q324L

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0782 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 88% (52/59)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,881,061 N190Y probably benign Het
2310035C23Rik T G 1: 105,687,347 N246K probably damaging Het
Abca6 T C 11: 110,184,670 M1332V probably benign Het
Afg3l2 T C 18: 67,440,443 K132R probably null Het
Arap3 T C 18: 37,984,365 D886G probably damaging Het
B3gntl1 G T 11: 121,651,676 probably null Het
Cdk12 T A 11: 98,219,074 S640R probably benign Het
Ceacam12 C A 7: 18,069,154 P162T probably benign Het
Chrna5 C A 9: 54,998,104 H67N probably benign Het
Copb1 T A 7: 114,219,572 D837V probably damaging Het
D11Wsu47e A G 11: 113,687,992 D71G probably benign Het
Dcaf5 C T 12: 80,338,832 R840H probably benign Het
Eef1e1 T C 13: 38,646,273 N141S probably damaging Het
Eif2ak4 A C 2: 118,412,963 N208T possibly damaging Het
Ext1 A G 15: 53,344,553 Y271H probably damaging Het
Fam173a A G 17: 25,790,657 V194A probably benign Het
Fbxo5 G A 10: 5,800,303 R323C possibly damaging Het
Fpr-rs3 C A 17: 20,624,226 A218S possibly damaging Het
Gm20499 G A 5: 114,817,021 probably benign Het
Gucy1b2 C A 14: 62,414,301 L400F possibly damaging Het
Hgd T A 16: 37,593,371 L24H probably benign Het
Hmx3 C A 7: 131,544,328 S255* probably null Het
Ifrd1 A T 12: 40,203,370 F448I probably damaging Het
Igfn1 T A 1: 135,966,840 E1996V probably benign Het
Itpr1 G A 6: 108,352,143 G173R probably damaging Het
Kbtbd8 T C 6: 95,118,534 S26P probably benign Het
Kctd17 A T 15: 78,437,133 probably benign Het
Matr3 T C 18: 35,584,522 S258P possibly damaging Het
Mpp4 G A 1: 59,151,666 A90V probably benign Het
Mrpl20 G A 4: 155,806,921 R34Q probably damaging Het
Neb A T 2: 52,245,301 S3266T probably damaging Het
Nipal3 A G 4: 135,452,339 probably benign Het
Npas2 A T 1: 39,287,571 T46S possibly damaging Het
Nsd3 G T 8: 25,682,669 E815* probably null Het
Nup98 C A 7: 102,152,361 V786L probably benign Het
Olfr730 A T 14: 50,186,746 M157K possibly damaging Het
Pcdhb3 T C 18: 37,301,467 V162A probably benign Het
Pcgf2 G A 11: 97,690,291 P58L probably damaging Het
Penk A G 4: 4,134,318 F110L probably damaging Het
Scfd1 A G 12: 51,431,529 N508S probably benign Het
Scn2a T C 2: 65,764,483 V1892A probably benign Het
Sema6a G A 18: 47,248,826 R885C probably damaging Het
Sik2 T C 9: 50,895,845 H755R probably benign Het
Slc36a3 A T 11: 55,135,268 Y241* probably null Het
Smg5 T C 3: 88,351,618 probably benign Het
Spag9 A G 11: 94,114,253 T1049A probably benign Het
Tas2r103 T C 6: 133,036,945 M53V probably benign Het
Tpr C T 1: 150,423,541 A1090V probably damaging Het
Traf5 T A 1: 191,997,672 R473W probably damaging Het
Ush2a T C 1: 188,443,510 probably null Het
Vit A G 17: 78,546,426 T34A probably benign Het
Other mutations in Ect2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01555:Ect2l APN 10 18130730 missense probably damaging 1.00
IGL01773:Ect2l APN 10 18161504 missense probably damaging 0.97
IGL02293:Ect2l APN 10 18140511 critical splice donor site probably null
IGL02589:Ect2l APN 10 18140594 splice site probably benign
IGL02866:Ect2l APN 10 18159817 missense probably damaging 1.00
R0037:Ect2l UTSW 10 18143097 missense probably damaging 1.00
R0526:Ect2l UTSW 10 18199940 missense possibly damaging 0.92
R0628:Ect2l UTSW 10 18143040 missense probably damaging 1.00
R0839:Ect2l UTSW 10 18141904 missense probably benign 0.03
R0948:Ect2l UTSW 10 18140586 missense probably damaging 1.00
R1103:Ect2l UTSW 10 18140526 missense probably damaging 1.00
R1238:Ect2l UTSW 10 18143104 missense possibly damaging 0.94
R1326:Ect2l UTSW 10 18165542 missense probably benign 0.00
R1327:Ect2l UTSW 10 18165542 missense probably benign 0.00
R1544:Ect2l UTSW 10 18168434 missense probably benign 0.04
R1848:Ect2l UTSW 10 18200033 missense probably damaging 1.00
R1921:Ect2l UTSW 10 18143004 missense possibly damaging 0.89
R1938:Ect2l UTSW 10 18144635 missense probably benign 0.00
R2081:Ect2l UTSW 10 18165527 missense probably damaging 1.00
R3551:Ect2l UTSW 10 18163393 missense probably damaging 1.00
R3608:Ect2l UTSW 10 18142940 missense possibly damaging 0.92
R3886:Ect2l UTSW 10 18168458 missense probably damaging 1.00
R4120:Ect2l UTSW 10 18130718 missense probably benign 0.00
R4348:Ect2l UTSW 10 18136988 missense probably damaging 1.00
R4992:Ect2l UTSW 10 18172729 missense probably benign 0.00
R5053:Ect2l UTSW 10 18140345 missense probably damaging 1.00
R5144:Ect2l UTSW 10 18144577 missense probably benign 0.03
R5654:Ect2l UTSW 10 18143062 missense probably damaging 0.99
R5814:Ect2l UTSW 10 18200009 missense probably damaging 0.97
R6053:Ect2l UTSW 10 18141844 missense probably damaging 1.00
R6057:Ect2l UTSW 10 18161502 missense probably benign 0.02
R6244:Ect2l UTSW 10 18140397 missense possibly damaging 0.93
R6720:Ect2l UTSW 10 18140264 missense probably damaging 1.00
R6817:Ect2l UTSW 10 18174059 missense probably benign 0.00
R6894:Ect2l UTSW 10 18169380 critical splice donor site probably null
R7199:Ect2l UTSW 10 18129146 missense probably benign 0.02
R7313:Ect2l UTSW 10 18168401 missense probably damaging 0.98
R7404:Ect2l UTSW 10 18159781 missense probably damaging 0.99
R7482:Ect2l UTSW 10 18168454 missense probably benign 0.07
R7751:Ect2l UTSW 10 18169405 missense possibly damaging 0.82
R7752:Ect2l UTSW 10 18141964 missense possibly damaging 0.94
R7880:Ect2l UTSW 10 18136954 missense possibly damaging 0.60
R7901:Ect2l UTSW 10 18141964 missense possibly damaging 0.94
R7963:Ect2l UTSW 10 18136954 missense possibly damaging 0.60
R7984:Ect2l UTSW 10 18141964 missense possibly damaging 0.94
X0018:Ect2l UTSW 10 18130652 missense probably benign 0.02
Z1177:Ect2l UTSW 10 18172672 missense not run
Predicted Primers PCR Primer
(F):5'- GGAGAGACGTATATCAGCACTG -3'
(R):5'- TCAGTAAAGCCTGACTGCCTC -3'

Sequencing Primer
(F):5'- ACAGCTGCTAGTTACTGAGGC -3'
(R):5'- CAGGAGAAACCCAAGGATTATTTTCC -3'
Posted On2016-12-15