Incidental Mutation 'R5779:Spag9'
ID446884
Institutional Source Beutler Lab
Gene Symbol Spag9
Ensembl Gene ENSMUSG00000020859
Gene Namesperm associated antigen 9
Synonymssyd1, JIP4, Mapk8ip4, 4733401I23Rik, JLP, 3110018C07Rik, 4831406C20Rik
MMRRC Submission 043377-MU
Accession Numbers

Genbank: NM_027569; MGI: 1918084

Is this an essential gene? Probably essential (E-score: 0.763) question?
Stock #R5779 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location93996091-94126085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94114253 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1049 (T1049A)
Ref Sequence ENSEMBL: ENSMUSP00000075115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024979] [ENSMUST00000041956] [ENSMUST00000075695] [ENSMUST00000092777] [ENSMUST00000103168] [ENSMUST00000153076]
Predicted Effect probably benign
Transcript: ENSMUST00000024979
AA Change: T1050A

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000024979
Gene: ENSMUSG00000020859
AA Change: T1050A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 253 305 1e-25 PDB
low complexity region 306 339 N/A INTRINSIC
coiled coil region 572 606 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
SCOP:d1kb0a2 823 969 3e-5 SMART
Blast:WD40 924 964 8e-18 BLAST
low complexity region 1132 1150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041956
AA Change: T1188A

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000042271
Gene: ENSMUSG00000020859
AA Change: T1188A

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 24 179 2e-61 PFAM
Pfam:JIP_LZII 390 460 5.3e-32 PFAM
coiled coil region 710 744 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
SCOP:d1kb0a2 961 1107 1e-5 SMART
Blast:WD40 1062 1102 1e-17 BLAST
low complexity region 1270 1288 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075695
AA Change: T1049A

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000075115
Gene: ENSMUSG00000020859
AA Change: T1049A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 253 305 1e-25 PDB
low complexity region 306 339 N/A INTRINSIC
coiled coil region 571 605 N/A INTRINSIC
low complexity region 734 750 N/A INTRINSIC
SCOP:d1kb0a2 822 968 3e-5 SMART
Blast:WD40 923 963 7e-18 BLAST
low complexity region 1131 1149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092777
AA Change: T1050A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000090452
Gene: ENSMUSG00000020859
AA Change: T1050A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 254 306 1e-25 PDB
low complexity region 307 340 N/A INTRINSIC
coiled coil region 572 606 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
SCOP:d1kb0a2 823 969 3e-5 SMART
Blast:WD40 924 964 7e-18 BLAST
low complexity region 1132 1150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103168
AA Change: T1045A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099457
Gene: ENSMUSG00000020859
AA Change: T1045A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 249 301 1e-25 PDB
low complexity region 302 335 N/A INTRINSIC
coiled coil region 567 601 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
SCOP:d1kb0a2 818 964 3e-5 SMART
Blast:WD40 919 959 8e-18 BLAST
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153076
AA Change: T782A

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000117502
Gene: ENSMUSG00000020859
AA Change: T782A

DomainStartEndE-ValueType
PDB:2W83|D 1 25 4e-8 PDB
low complexity region 26 59 N/A INTRINSIC
coiled coil region 291 325 N/A INTRINSIC
low complexity region 454 470 N/A INTRINSIC
SCOP:d1kb0a2 542 688 3e-5 SMART
Blast:WD40 643 683 1e-17 BLAST
low complexity region 864 882 N/A INTRINSIC
Meta Mutation Damage Score 0.0683 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 88% (52/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cancer testis antigen gene family. The encoded protein functions as a scaffold protein that structurally organizes mitogen-activated protein kinases and mediates c-Jun-terminal kinase signaling. This protein also binds to kinesin-1 and may be involved in microtubule-based membrane transport. This protein may play a role in tumor growth and development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Male mice homozygous for a null mutation display reduced fertility with oligoasthenozoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,881,061 N190Y probably benign Het
2310035C23Rik T G 1: 105,687,347 N246K probably damaging Het
Abca6 T C 11: 110,184,670 M1332V probably benign Het
Afg3l2 T C 18: 67,440,443 K132R probably null Het
Arap3 T C 18: 37,984,365 D886G probably damaging Het
B3gntl1 G T 11: 121,651,676 probably null Het
Cdk12 T A 11: 98,219,074 S640R probably benign Het
Ceacam12 C A 7: 18,069,154 P162T probably benign Het
Chrna5 C A 9: 54,998,104 H67N probably benign Het
Copb1 T A 7: 114,219,572 D837V probably damaging Het
D11Wsu47e A G 11: 113,687,992 D71G probably benign Het
Dcaf5 C T 12: 80,338,832 R840H probably benign Het
Ect2l T A 10: 18,163,438 Q324L probably benign Het
Eef1e1 T C 13: 38,646,273 N141S probably damaging Het
Eif2ak4 A C 2: 118,412,963 N208T possibly damaging Het
Ext1 A G 15: 53,344,553 Y271H probably damaging Het
Fam173a A G 17: 25,790,657 V194A probably benign Het
Fbxo5 G A 10: 5,800,303 R323C possibly damaging Het
Fpr-rs3 C A 17: 20,624,226 A218S possibly damaging Het
Gm20499 G A 5: 114,817,021 probably benign Het
Gucy1b2 C A 14: 62,414,301 L400F possibly damaging Het
Hgd T A 16: 37,593,371 L24H probably benign Het
Hmx3 C A 7: 131,544,328 S255* probably null Het
Ifrd1 A T 12: 40,203,370 F448I probably damaging Het
Igfn1 T A 1: 135,966,840 E1996V probably benign Het
Itpr1 G A 6: 108,352,143 G173R probably damaging Het
Kbtbd8 T C 6: 95,118,534 S26P probably benign Het
Kctd17 A T 15: 78,437,133 probably benign Het
Matr3 T C 18: 35,584,522 S258P possibly damaging Het
Mpp4 G A 1: 59,151,666 A90V probably benign Het
Mrpl20 G A 4: 155,806,921 R34Q probably damaging Het
Neb A T 2: 52,245,301 S3266T probably damaging Het
Nipal3 A G 4: 135,452,339 probably benign Het
Npas2 A T 1: 39,287,571 T46S possibly damaging Het
Nsd3 G T 8: 25,682,669 E815* probably null Het
Nup98 C A 7: 102,152,361 V786L probably benign Het
Olfr730 A T 14: 50,186,746 M157K possibly damaging Het
Pcdhb3 T C 18: 37,301,467 V162A probably benign Het
Pcgf2 G A 11: 97,690,291 P58L probably damaging Het
Penk A G 4: 4,134,318 F110L probably damaging Het
Scfd1 A G 12: 51,431,529 N508S probably benign Het
Scn2a T C 2: 65,764,483 V1892A probably benign Het
Sema6a G A 18: 47,248,826 R885C probably damaging Het
Sik2 T C 9: 50,895,845 H755R probably benign Het
Slc36a3 A T 11: 55,135,268 Y241* probably null Het
Smg5 T C 3: 88,351,618 probably benign Het
Tas2r103 T C 6: 133,036,945 M53V probably benign Het
Tpr C T 1: 150,423,541 A1090V probably damaging Het
Traf5 T A 1: 191,997,672 R473W probably damaging Het
Ush2a T C 1: 188,443,510 probably null Het
Vit A G 17: 78,546,426 T34A probably benign Het
Other mutations in Spag9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Spag9 APN 11 94097866 missense probably benign 0.02
IGL01776:Spag9 APN 11 94116727 splice site probably benign
IGL02095:Spag9 APN 11 94108582 missense probably damaging 1.00
IGL02307:Spag9 APN 11 94102160 critical splice donor site probably null
IGL02417:Spag9 APN 11 94116741 missense probably benign 0.27
IGL02480:Spag9 APN 11 94108587 nonsense probably null
IGL02864:Spag9 APN 11 94106661 missense probably damaging 1.00
IGL02976:Spag9 APN 11 94083953 missense probably benign 0.30
IGL02979:Spag9 APN 11 94097364 missense probably benign
IGL03349:Spag9 APN 11 94093509 missense possibly damaging 0.51
dazzle UTSW 11 94093624 nonsense probably null
R0128:Spag9 UTSW 11 94093539 missense probably damaging 1.00
R0418:Spag9 UTSW 11 94091753 splice site probably benign
R1463:Spag9 UTSW 11 94116837 missense probably damaging 1.00
R1593:Spag9 UTSW 11 94097233 missense probably damaging 1.00
R1605:Spag9 UTSW 11 94048539 missense probably damaging 0.99
R1649:Spag9 UTSW 11 94108452 splice site probably null
R1697:Spag9 UTSW 11 93996565 missense probably benign 0.00
R1952:Spag9 UTSW 11 94097358 missense possibly damaging 0.77
R2011:Spag9 UTSW 11 94092375 nonsense probably null
R2012:Spag9 UTSW 11 94092375 nonsense probably null
R2351:Spag9 UTSW 11 94092900 missense probably damaging 1.00
R2367:Spag9 UTSW 11 94116757 missense probably damaging 1.00
R3027:Spag9 UTSW 11 94086377 missense probably null 1.00
R3766:Spag9 UTSW 11 94060283 intron probably benign
R3777:Spag9 UTSW 11 94099026 critical splice acceptor site probably null
R3937:Spag9 UTSW 11 94044417 missense possibly damaging 0.94
R3937:Spag9 UTSW 11 94044479 missense possibly damaging 0.92
R4417:Spag9 UTSW 11 94060346 intron probably benign
R4445:Spag9 UTSW 11 94097253 missense possibly damaging 0.95
R4711:Spag9 UTSW 11 94114351 critical splice donor site probably null
R4799:Spag9 UTSW 11 94048516 missense possibly damaging 0.87
R4799:Spag9 UTSW 11 94048517 missense probably damaging 0.96
R4816:Spag9 UTSW 11 94048599 intron probably benign
R4843:Spag9 UTSW 11 94097818 missense probably damaging 1.00
R5020:Spag9 UTSW 11 94097786 missense probably benign 0.08
R5119:Spag9 UTSW 11 94122722 missense probably damaging 1.00
R5298:Spag9 UTSW 11 94100135 missense probably damaging 1.00
R5304:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5305:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5395:Spag9 UTSW 11 94091751 splice site probably null
R5636:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5638:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5654:Spag9 UTSW 11 94090712 missense probably damaging 1.00
R5814:Spag9 UTSW 11 94082828 missense possibly damaging 0.94
R5912:Spag9 UTSW 11 94044425 missense probably damaging 0.98
R6038:Spag9 UTSW 11 94112092 missense probably damaging 1.00
R6038:Spag9 UTSW 11 94112092 missense probably damaging 1.00
R6269:Spag9 UTSW 11 94044507 missense probably benign 0.05
R6294:Spag9 UTSW 11 94093485 critical splice acceptor site probably null
R6389:Spag9 UTSW 11 94086311 missense probably damaging 1.00
R6420:Spag9 UTSW 11 94086302 missense probably damaging 1.00
R6460:Spag9 UTSW 11 94068975 missense probably damaging 1.00
R6482:Spag9 UTSW 11 94093502 missense possibly damaging 0.94
R6860:Spag9 UTSW 11 94081370 missense probably benign 0.25
R7086:Spag9 UTSW 11 94097864 missense probably benign
R7179:Spag9 UTSW 11 94089432 intron probably null
R7225:Spag9 UTSW 11 94097358 missense probably damaging 0.98
R7351:Spag9 UTSW 11 94092976 missense probably benign 0.00
R7366:Spag9 UTSW 11 94108521 missense possibly damaging 0.56
R7378:Spag9 UTSW 11 94114351 critical splice donor site probably null
R7401:Spag9 UTSW 11 94097689 missense probably benign
R7506:Spag9 UTSW 11 94108464 missense probably damaging 1.00
R7507:Spag9 UTSW 11 94068080 missense probably benign 0.00
R7513:Spag9 UTSW 11 94112083 missense probably damaging 1.00
R7655:Spag9 UTSW 11 93996563 missense possibly damaging 0.56
R7656:Spag9 UTSW 11 93996563 missense possibly damaging 0.56
R7664:Spag9 UTSW 11 94102160 critical splice donor site probably null
R7665:Spag9 UTSW 11 94013654 missense probably damaging 0.98
R7862:Spag9 UTSW 11 94112066 missense possibly damaging 0.69
R7945:Spag9 UTSW 11 94112066 missense possibly damaging 0.69
R7963:Spag9 UTSW 11 94071834 splice site probably null
R8074:Spag9 UTSW 11 94112051
Predicted Primers PCR Primer
(F):5'- CACTTACGTTATCTCAACTGGC -3'
(R):5'- ACTGAAATCGTGGGTAATCCTAG -3'

Sequencing Primer
(F):5'- ACGTTATCTCAACTGGCTGTAG -3'
(R):5'- CGTGGGTAATCCTAGTAATTTAGTG -3'
Posted On2016-12-15