Incidental Mutation 'R5779:Pcgf2'
ID446885
Institutional Source Beutler Lab
Gene Symbol Pcgf2
Ensembl Gene ENSMUSG00000018537
Gene Namepolycomb group ring finger 2
Synonymsmel-18, Rnf110, Zfp144
MMRRC Submission 043377-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5779 (G1)
Quality Score196
Status Validated
Chromosome11
Chromosomal Location97688823-97700497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 97690291 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 58 (P58L)
Ref Sequence ENSEMBL: ENSMUSP00000099438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018681] [ENSMUST00000044730] [ENSMUST00000103148] [ENSMUST00000103149] [ENSMUST00000107583] [ENSMUST00000107584] [ENSMUST00000107585] [ENSMUST00000107586] [ENSMUST00000169807] [ENSMUST00000179765]
Predicted Effect probably damaging
Transcript: ENSMUST00000018681
AA Change: P242L

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000018681
Gene: ENSMUSG00000018537
AA Change: P242L

DomainStartEndE-ValueType
RING 18 56 4.99e-5 SMART
low complexity region 263 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000044730
SMART Domains Protein: ENSMUSP00000045445
Gene: ENSMUSG00000038437

DomainStartEndE-ValueType
PHD 7 55 5.92e-7 SMART
PHD 119 178 5e-5 SMART
low complexity region 190 224 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 290 330 N/A INTRINSIC
low complexity region 358 380 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 520 536 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 649 666 N/A INTRINSIC
coiled coil region 703 744 N/A INTRINSIC
low complexity region 746 756 N/A INTRINSIC
low complexity region 773 782 N/A INTRINSIC
low complexity region 802 848 N/A INTRINSIC
low complexity region 860 901 N/A INTRINSIC
coiled coil region 915 942 N/A INTRINSIC
low complexity region 995 1018 N/A INTRINSIC
low complexity region 1026 1037 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103148
AA Change: P242L

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099437
Gene: ENSMUSG00000018537
AA Change: P242L

DomainStartEndE-ValueType
RING 18 56 4.99e-5 SMART
low complexity region 263 318 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103149
AA Change: P58L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099438
Gene: ENSMUSG00000018537
AA Change: P58L

DomainStartEndE-ValueType
low complexity region 79 134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107583
SMART Domains Protein: ENSMUSP00000103209
Gene: ENSMUSG00000078695

DomainStartEndE-ValueType
ZnF_CDGSH 54 88 3.39e-9 SMART
ZnF_CDGSH 92 129 5.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107584
SMART Domains Protein: ENSMUSP00000103210
Gene: ENSMUSG00000078695

DomainStartEndE-ValueType
ZnF_CDGSH 32 66 3.39e-9 SMART
ZnF_CDGSH 70 107 5.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107585
SMART Domains Protein: ENSMUSP00000103211
Gene: ENSMUSG00000078695

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
ZnF_CDGSH 51 85 3.39e-9 SMART
ZnF_CDGSH 89 126 5.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107586
SMART Domains Protein: ENSMUSP00000103212
Gene: ENSMUSG00000038437

DomainStartEndE-ValueType
PHD 7 55 5.92e-7 SMART
PHD 119 178 5e-5 SMART
low complexity region 190 224 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 290 330 N/A INTRINSIC
low complexity region 336 356 N/A INTRINSIC
low complexity region 388 410 N/A INTRINSIC
low complexity region 428 442 N/A INTRINSIC
low complexity region 517 528 N/A INTRINSIC
low complexity region 532 546 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 609 631 N/A INTRINSIC
low complexity region 679 696 N/A INTRINSIC
coiled coil region 733 774 N/A INTRINSIC
low complexity region 776 786 N/A INTRINSIC
low complexity region 803 812 N/A INTRINSIC
low complexity region 832 878 N/A INTRINSIC
low complexity region 890 931 N/A INTRINSIC
coiled coil region 945 972 N/A INTRINSIC
low complexity region 1025 1048 N/A INTRINSIC
low complexity region 1056 1067 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145623
Predicted Effect probably damaging
Transcript: ENSMUST00000169807
AA Change: P242L

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126967
Gene: ENSMUSG00000018537
AA Change: P242L

DomainStartEndE-ValueType
RING 18 56 4.99e-5 SMART
Pfam:RAWUL 146 228 1.9e-26 PFAM
low complexity region 263 318 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179765
AA Change: P242L

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137517
Gene: ENSMUSG00000018537
AA Change: P242L

DomainStartEndE-ValueType
RING 18 56 4.99e-5 SMART
low complexity region 263 318 N/A INTRINSIC
Meta Mutation Damage Score 0.0808 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 88% (52/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger motif and is similar to the polycomb group (PcG) gene products. PcG gene products form complexes via protein-protein interaction and maintain the transcription repression of genes involved in embryogenesis, cell cycles, and tumorigenesis. This protein was shown to act as a negative regulator of transcription and has tumor suppressor activity. The expression of this gene was detected in various tumor cells, but is limited in neural organs in normal tissues. Knockout studies in mice suggested that this protein may negatively regulate the expression of different cytokines, chemokines, and chemokine receptors, and thus plays an important role in lymphocyte differentiation and migration, as well as in immune responses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit multiple abnormalities of the axial skeleton (including homeotic transformations), grow markedly slower, and die either perinatally or between 3-6 weeks of age depending on genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,881,061 N190Y probably benign Het
2310035C23Rik T G 1: 105,687,347 N246K probably damaging Het
Abca6 T C 11: 110,184,670 M1332V probably benign Het
Afg3l2 T C 18: 67,440,443 K132R probably null Het
Arap3 T C 18: 37,984,365 D886G probably damaging Het
B3gntl1 G T 11: 121,651,676 probably null Het
Cdk12 T A 11: 98,219,074 S640R probably benign Het
Ceacam12 C A 7: 18,069,154 P162T probably benign Het
Chrna5 C A 9: 54,998,104 H67N probably benign Het
Copb1 T A 7: 114,219,572 D837V probably damaging Het
D11Wsu47e A G 11: 113,687,992 D71G probably benign Het
Dcaf5 C T 12: 80,338,832 R840H probably benign Het
Ect2l T A 10: 18,163,438 Q324L probably benign Het
Eef1e1 T C 13: 38,646,273 N141S probably damaging Het
Eif2ak4 A C 2: 118,412,963 N208T possibly damaging Het
Ext1 A G 15: 53,344,553 Y271H probably damaging Het
Fam173a A G 17: 25,790,657 V194A probably benign Het
Fbxo5 G A 10: 5,800,303 R323C possibly damaging Het
Fpr-rs3 C A 17: 20,624,226 A218S possibly damaging Het
Gm20499 G A 5: 114,817,021 probably benign Het
Gucy1b2 C A 14: 62,414,301 L400F possibly damaging Het
Hgd T A 16: 37,593,371 L24H probably benign Het
Hmx3 C A 7: 131,544,328 S255* probably null Het
Ifrd1 A T 12: 40,203,370 F448I probably damaging Het
Igfn1 T A 1: 135,966,840 E1996V probably benign Het
Itpr1 G A 6: 108,352,143 G173R probably damaging Het
Kbtbd8 T C 6: 95,118,534 S26P probably benign Het
Kctd17 A T 15: 78,437,133 probably benign Het
Matr3 T C 18: 35,584,522 S258P possibly damaging Het
Mpp4 G A 1: 59,151,666 A90V probably benign Het
Mrpl20 G A 4: 155,806,921 R34Q probably damaging Het
Neb A T 2: 52,245,301 S3266T probably damaging Het
Nipal3 A G 4: 135,452,339 probably benign Het
Npas2 A T 1: 39,287,571 T46S possibly damaging Het
Nsd3 G T 8: 25,682,669 E815* probably null Het
Nup98 C A 7: 102,152,361 V786L probably benign Het
Olfr730 A T 14: 50,186,746 M157K possibly damaging Het
Pcdhb3 T C 18: 37,301,467 V162A probably benign Het
Penk A G 4: 4,134,318 F110L probably damaging Het
Scfd1 A G 12: 51,431,529 N508S probably benign Het
Scn2a T C 2: 65,764,483 V1892A probably benign Het
Sema6a G A 18: 47,248,826 R885C probably damaging Het
Sik2 T C 9: 50,895,845 H755R probably benign Het
Slc36a3 A T 11: 55,135,268 Y241* probably null Het
Smg5 T C 3: 88,351,618 probably benign Het
Spag9 A G 11: 94,114,253 T1049A probably benign Het
Tas2r103 T C 6: 133,036,945 M53V probably benign Het
Tpr C T 1: 150,423,541 A1090V probably damaging Het
Traf5 T A 1: 191,997,672 R473W probably damaging Het
Ush2a T C 1: 188,443,510 probably null Het
Vit A G 17: 78,546,426 T34A probably benign Het
Other mutations in Pcgf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Pcgf2 APN 11 97690240 missense probably benign 0.01
IGL01877:Pcgf2 APN 11 97692533 missense probably damaging 1.00
IGL02473:Pcgf2 APN 11 97691921 splice site probably benign
R0243:Pcgf2 UTSW 11 97692418 unclassified probably null
R0522:Pcgf2 UTSW 11 97692047 missense probably benign 0.31
R0712:Pcgf2 UTSW 11 97691004 missense probably damaging 1.00
R0781:Pcgf2 UTSW 11 97691850 splice site probably benign
R1110:Pcgf2 UTSW 11 97691850 splice site probably benign
R4295:Pcgf2 UTSW 11 97693456 nonsense probably null
R4959:Pcgf2 UTSW 11 97691689 missense possibly damaging 0.85
R5569:Pcgf2 UTSW 11 97692367 critical splice donor site probably null
R5622:Pcgf2 UTSW 11 97690252 missense probably damaging 1.00
R6001:Pcgf2 UTSW 11 97692780 missense possibly damaging 0.91
R6090:Pcgf2 UTSW 11 97690991 missense possibly damaging 0.71
R6360:Pcgf2 UTSW 11 97692409 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TTTGCAGGCAGTTCGAAGTG -3'
(R):5'- TGTCTCTTCACTCTGCAGGG -3'

Sequencing Primer
(F):5'- TTCGAAGTGCCCCCATTGGTAG -3'
(R):5'- TTCACTCTGCAGGGCTCAGAC -3'
Posted On2016-12-15