Mutagenetix > Incidental Mutation

Incidental Mutation 'R5779:Ext1'

446895

Institutional Source

Beutler Lab

Gene Symbol

Ext1

Ensembl Gene

ENSMUSG00000061731

Gene Name

exostoses (multiple) 1

Synonyms

MMRRC Submission

043377-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5779 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53064038-53346159 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 53344553 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 271 (Y271H)

Ref Sequence

ENSEMBL: ENSMUSP00000076505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077273] [ENSMUST00000133362]

AlphaFold

P97464

Predicted Effect

probably damaging
Transcript: ENSMUST00000077273
AA Change: Y271H

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000076505
Gene: ENSMUSG00000061731
AA Change: Y271H

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
low complexity region	29	41	N/A	INTRINSIC
Pfam:Exostosin	110	396	6e-64	PFAM
Pfam:Glyco_transf_64	480	729	1.1e-106	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000133362

Meta Mutation Damage Score

0.9152

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

88% (52/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	T	17: 56,881,061	N190Y	probably benign	Het
2310035C23Rik	T	G	1: 105,687,347	N246K	probably damaging	Het
Abca6	T	C	11: 110,184,670	M1332V	probably benign	Het
Afg3l2	T	C	18: 67,440,443	K132R	probably null	Het
Arap3	T	C	18: 37,984,365	D886G	probably damaging	Het
B3gntl1	G	T	11: 121,651,676		probably null	Het
Cdk12	T	A	11: 98,219,074	S640R	probably benign	Het
Ceacam12	C	A	7: 18,069,154	P162T	probably benign	Het
Chrna5	C	A	9: 54,998,104	H67N	probably benign	Het
Copb1	T	A	7: 114,219,572	D837V	probably damaging	Het
D11Wsu47e	A	G	11: 113,687,992	D71G	probably benign	Het
Dcaf5	C	T	12: 80,338,832	R840H	probably benign	Het
Ect2l	T	A	10: 18,163,438	Q324L	probably benign	Het
Eef1e1	T	C	13: 38,646,273	N141S	probably damaging	Het
Eif2ak4	A	C	2: 118,412,963	N208T	possibly damaging	Het
Fam173a	A	G	17: 25,790,657	V194A	probably benign	Het
Fbxo5	G	A	10: 5,800,303	R323C	possibly damaging	Het
Fpr-rs3	C	A	17: 20,624,226	A218S	possibly damaging	Het
Gm20499	G	A	5: 114,817,021		probably benign	Het
Gucy1b2	C	A	14: 62,414,301	L400F	possibly damaging	Het
Hgd	T	A	16: 37,593,371	L24H	probably benign	Het
Hmx3	C	A	7: 131,544,328	S255*	probably null	Het
Ifrd1	A	T	12: 40,203,370	F448I	probably damaging	Het
Igfn1	T	A	1: 135,966,840	E1996V	probably benign	Het
Itpr1	G	A	6: 108,352,143	G173R	probably damaging	Het
Kbtbd8	T	C	6: 95,118,534	S26P	probably benign	Het
Kctd17	A	T	15: 78,437,133		probably benign	Het
Matr3	T	C	18: 35,584,522	S258P	possibly damaging	Het
Mpp4	G	A	1: 59,151,666	A90V	probably benign	Het
Mrpl20	G	A	4: 155,806,921	R34Q	probably damaging	Het
Neb	A	T	2: 52,245,301	S3266T	probably damaging	Het
Nipal3	A	G	4: 135,452,339		probably benign	Het
Npas2	A	T	1: 39,287,571	T46S	possibly damaging	Het
Nsd3	G	T	8: 25,682,669	E815*	probably null	Het
Nup98	C	A	7: 102,152,361	V786L	probably benign	Het
Olfr730	A	T	14: 50,186,746	M157K	possibly damaging	Het
Pcdhb3	T	C	18: 37,301,467	V162A	probably benign	Het
Pcgf2	G	A	11: 97,690,291	P58L	probably damaging	Het
Penk	A	G	4: 4,134,318	F110L	probably damaging	Het
Scfd1	A	G	12: 51,431,529	N508S	probably benign	Het
Scn2a	T	C	2: 65,764,483	V1892A	probably benign	Het
Sema6a	G	A	18: 47,248,826	R885C	probably damaging	Het
Sik2	T	C	9: 50,895,845	H755R	probably benign	Het
Slc36a3	A	T	11: 55,135,268	Y241*	probably null	Het
Smg5	T	C	3: 88,351,618		probably benign	Het
Spag9	A	G	11: 94,114,253	T1049A	probably benign	Het
Tas2r103	T	C	6: 133,036,945	M53V	probably benign	Het
Tpr	C	T	1: 150,423,541	A1090V	probably damaging	Het
Traf5	T	A	1: 191,997,672	R473W	probably damaging	Het
Ush2a	T	C	1: 188,443,510		probably null	Het
Vit	A	G	17: 78,546,426	T34A	probably benign	Het

Other mutations in Ext1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00710:Ext1	APN	15	53344873	missense	probably damaging	1.00
IGL02081:Ext1	APN	15	53073446	nonsense	probably null
IGL03147:Ext1	UTSW	15	53088072	missense	probably damaging	0.98
R0047:Ext1	UTSW	15	53345146	missense	probably benign
R0047:Ext1	UTSW	15	53345146	missense	probably benign
R0437:Ext1	UTSW	15	53106106	missense	probably damaging	1.00
R0881:Ext1	UTSW	15	53344483	missense	probably benign	0.23
R1882:Ext1	UTSW	15	53075792	missense	probably damaging	1.00
R2135:Ext1	UTSW	15	53101744	missense	possibly damaging	0.88
R2175:Ext1	UTSW	15	53068728	missense	probably damaging	1.00
R2762:Ext1	UTSW	15	53344927	missense	probably benign	0.29
R3162:Ext1	UTSW	15	53344604	missense	possibly damaging	0.82
R3162:Ext1	UTSW	15	53344604	missense	possibly damaging	0.82
R3752:Ext1	UTSW	15	53075910	missense	probably damaging	1.00
R3815:Ext1	UTSW	15	53345089	missense	probably benign	0.05
R4096:Ext1	UTSW	15	53073357	missense	probably damaging	1.00
R4298:Ext1	UTSW	15	53345125	missense	probably benign	0.02
R4362:Ext1	UTSW	15	53107591	intron	probably benign
R4550:Ext1	UTSW	15	53101786	missense	probably damaging	0.99
R4647:Ext1	UTSW	15	53089987	missense	possibly damaging	0.95
R4648:Ext1	UTSW	15	53089987	missense	possibly damaging	0.95
R4871:Ext1	UTSW	15	53092377	missense	probably benign	0.37
R4954:Ext1	UTSW	15	53344492	missense	probably damaging	1.00
R5010:Ext1	UTSW	15	53092412	missense	probably damaging	1.00
R5153:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5155:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5328:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5385:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5542:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5555:Ext1	UTSW	15	53088143	missense	probably damaging	1.00
R5874:Ext1	UTSW	15	53101752	missense	possibly damaging	0.61
R6401:Ext1	UTSW	15	53106097	missense	possibly damaging	0.94
R6604:Ext1	UTSW	15	53083159	missense	probably damaging	0.99
R6847:Ext1	UTSW	15	53345154	missense	probably benign
R6885:Ext1	UTSW	15	53101692	missense	probably damaging	1.00
R7212:Ext1	UTSW	15	53345162	missense	probably benign	0.00
R7315:Ext1	UTSW	15	53073387	missense	probably damaging	1.00
R7361:Ext1	UTSW	15	53344723	missense	probably damaging	1.00
R7474:Ext1	UTSW	15	53344489	missense	probably damaging	0.98
R7853:Ext1	UTSW	15	53107485	missense	probably damaging	0.96
R7860:Ext1	UTSW	15	53089939	missense	possibly damaging	0.84
R8013:Ext1	UTSW	15	53075887	missense	possibly damaging	0.78
R8014:Ext1	UTSW	15	53075887	missense	possibly damaging	0.78
R8725:Ext1	UTSW	15	53344669	missense	possibly damaging	0.91
R8888:Ext1	UTSW	15	53092327	missense	probably damaging	1.00
R9162:Ext1	UTSW	15	53345108	nonsense	probably null
R9342:Ext1	UTSW	15	53345128	missense	probably benign
R9587:Ext1	UTSW	15	53092412	missense	possibly damaging	0.53
R9663:Ext1	UTSW	15	53345060	missense	probably damaging	0.96
R9753:Ext1	UTSW	15	53344671	missense	probably damaging	1.00
X0021:Ext1	UTSW	15	53345273	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGCAGCCCTTACTCACTTC -3'
(R):5'- GTCTCCACTTGTGGAACAATGG -3'

Sequencing Primer
(F):5'- ACTCACTTCTCATACTCGGTGTTG -3'
(R):5'- ACTTGGCCTGACTACACTGAG -3'

Posted On

2016-12-15