Incidental Mutation 'R5779:Hgd'
ID446897
Institutional Source Beutler Lab
Gene Symbol Hgd
Ensembl Gene ENSMUSG00000022821
Gene Namehomogentisate 1, 2-dioxygenase
Synonyms
MMRRC Submission 043377-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5779 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location37580153-37632020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37593371 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 24 (L24H)
Ref Sequence ENSEMBL: ENSMUSP00000156254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159787] [ENSMUST00000160847]
Predicted Effect probably benign
Transcript: ENSMUST00000159787
AA Change: L24H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000160847
AA Change: L65H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125492
Gene: ENSMUSG00000022821
AA Change: L65H

DomainStartEndE-ValueType
Pfam:HgmA 5 434 2e-225 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231668
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 88% (52/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme homogentisate 1,2 dioxygenase. This enzyme is involved in the catabolism of the amino acids tyrosine and phenylalanine. Mutations in this gene are the cause of the autosomal recessive metabolism disorder alkaptonuria.[provided by RefSeq, May 2010]
PHENOTYPE: Mutations in this gene result in high levels of urinary homogentisic acid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,881,061 N190Y probably benign Het
2310035C23Rik T G 1: 105,687,347 N246K probably damaging Het
Abca6 T C 11: 110,184,670 M1332V probably benign Het
Afg3l2 T C 18: 67,440,443 K132R probably null Het
Arap3 T C 18: 37,984,365 D886G probably damaging Het
B3gntl1 G T 11: 121,651,676 probably null Het
Cdk12 T A 11: 98,219,074 S640R probably benign Het
Ceacam12 C A 7: 18,069,154 P162T probably benign Het
Chrna5 C A 9: 54,998,104 H67N probably benign Het
Copb1 T A 7: 114,219,572 D837V probably damaging Het
D11Wsu47e A G 11: 113,687,992 D71G probably benign Het
Dcaf5 C T 12: 80,338,832 R840H probably benign Het
Ect2l T A 10: 18,163,438 Q324L probably benign Het
Eef1e1 T C 13: 38,646,273 N141S probably damaging Het
Eif2ak4 A C 2: 118,412,963 N208T possibly damaging Het
Ext1 A G 15: 53,344,553 Y271H probably damaging Het
Fam173a A G 17: 25,790,657 V194A probably benign Het
Fbxo5 G A 10: 5,800,303 R323C possibly damaging Het
Fpr-rs3 C A 17: 20,624,226 A218S possibly damaging Het
Gm20499 G A 5: 114,817,021 probably benign Het
Gucy1b2 C A 14: 62,414,301 L400F possibly damaging Het
Hmx3 C A 7: 131,544,328 S255* probably null Het
Ifrd1 A T 12: 40,203,370 F448I probably damaging Het
Igfn1 T A 1: 135,966,840 E1996V probably benign Het
Itpr1 G A 6: 108,352,143 G173R probably damaging Het
Kbtbd8 T C 6: 95,118,534 S26P probably benign Het
Kctd17 A T 15: 78,437,133 probably benign Het
Matr3 T C 18: 35,584,522 S258P possibly damaging Het
Mpp4 G A 1: 59,151,666 A90V probably benign Het
Mrpl20 G A 4: 155,806,921 R34Q probably damaging Het
Neb A T 2: 52,245,301 S3266T probably damaging Het
Nipal3 A G 4: 135,452,339 probably benign Het
Npas2 A T 1: 39,287,571 T46S possibly damaging Het
Nsd3 G T 8: 25,682,669 E815* probably null Het
Nup98 C A 7: 102,152,361 V786L probably benign Het
Olfr730 A T 14: 50,186,746 M157K possibly damaging Het
Pcdhb3 T C 18: 37,301,467 V162A probably benign Het
Pcgf2 G A 11: 97,690,291 P58L probably damaging Het
Penk A G 4: 4,134,318 F110L probably damaging Het
Scfd1 A G 12: 51,431,529 N508S probably benign Het
Scn2a T C 2: 65,764,483 V1892A probably benign Het
Sema6a G A 18: 47,248,826 R885C probably damaging Het
Sik2 T C 9: 50,895,845 H755R probably benign Het
Slc36a3 A T 11: 55,135,268 Y241* probably null Het
Smg5 T C 3: 88,351,618 probably benign Het
Spag9 A G 11: 94,114,253 T1049A probably benign Het
Tas2r103 T C 6: 133,036,945 M53V probably benign Het
Tpr C T 1: 150,423,541 A1090V probably damaging Het
Traf5 T A 1: 191,997,672 R473W probably damaging Het
Ush2a T C 1: 188,443,510 probably null Het
Vit A G 17: 78,546,426 T34A probably benign Het
Other mutations in Hgd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Hgd APN 16 37613249 missense probably damaging 1.00
IGL00851:Hgd APN 16 37631695 missense probably damaging 0.98
IGL01339:Hgd APN 16 37631730 missense possibly damaging 0.72
IGL01627:Hgd APN 16 37621925 missense probably damaging 0.96
IGL02565:Hgd APN 16 37615387 missense possibly damaging 0.88
IGL03098:Hgd UTSW 16 37616245 missense probably benign 0.44
R0346:Hgd UTSW 16 37588774 splice site probably benign
R0360:Hgd UTSW 16 37611184 splice site probably benign
R0426:Hgd UTSW 16 37588685 splice site probably benign
R0799:Hgd UTSW 16 37628609 splice site probably benign
R1178:Hgd UTSW 16 37615394 missense possibly damaging 0.95
R2921:Hgd UTSW 16 37618968 missense probably damaging 1.00
R2922:Hgd UTSW 16 37618968 missense probably damaging 1.00
R4791:Hgd UTSW 16 37631825 makesense probably null
R4859:Hgd UTSW 16 37588749 missense probably damaging 1.00
R5289:Hgd UTSW 16 37628551 missense possibly damaging 0.94
R5368:Hgd UTSW 16 37589751 missense probably benign 0.33
R6140:Hgd UTSW 16 37589713 missense probably benign 0.04
R6160:Hgd UTSW 16 37613298 missense probably damaging 1.00
R6636:Hgd UTSW 16 37615374 missense possibly damaging 0.75
R7196:Hgd UTSW 16 37588716 missense probably benign 0.03
R7450:Hgd UTSW 16 37624324 missense possibly damaging 0.88
R7580:Hgd UTSW 16 37618879 missense possibly damaging 0.67
R7720:Hgd UTSW 16 37593435 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGCCTGAAGAGCAATGG -3'
(R):5'- AGTTTTCAATAACTTTGGCCCCAG -3'

Sequencing Primer
(F):5'- GTTACAGCCAGGAGACATTACTG -3'
(R):5'- AACTTTGGCCCCAGTGTAAG -3'
Posted On2016-12-15