Incidental Mutation 'R5779:Matr3'
ID446902
Institutional Source Beutler Lab
Gene Symbol Matr3
Ensembl Gene ENSMUSG00000037236
Gene Namematrin 3
Synonyms2810017I02Rik, D030046F20Rik, 1110061A14Rik
MMRRC Submission 043377-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R5779 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location35562146-35593835 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35584522 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 258 (S258P)
Ref Sequence ENSEMBL: ENSMUSP00000140853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166793] [ENSMUST00000186796] [ENSMUST00000187389] [ENSMUST00000187793] [ENSMUST00000188275] [ENSMUST00000188767] [ENSMUST00000190029] [ENSMUST00000190121] [ENSMUST00000190653]
Predicted Effect probably benign
Transcript: ENSMUST00000166793
AA Change: S596P

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125761
Gene: ENSMUSG00000037236
AA Change: S596P

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186796
AA Change: S258P

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140128
Gene: ENSMUSG00000037236
AA Change: S258P

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187389
AA Change: S596P

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139745
Gene: ENSMUSG00000037236
AA Change: S596P

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187793
SMART Domains Protein: ENSMUSP00000140047
Gene: ENSMUSG00000099703

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
SCOP:d1lvk_2 42 78 4e-3 SMART
PDB:1X4D|A 52 102 4e-30 PDB
Blast:RRM 61 102 1e-22 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000188275
AA Change: S308P

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140401
Gene: ENSMUSG00000037236
AA Change: S308P

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
RRM 111 181 3.2e-5 SMART
RRM 209 279 2.4e-11 SMART
low complexity region 362 387 N/A INTRINSIC
low complexity region 422 430 N/A INTRINSIC
ZnF_U1 509 544 1.1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188767
SMART Domains Protein: ENSMUSP00000141027
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189019
Predicted Effect probably benign
Transcript: ENSMUST00000190029
AA Change: S596P

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140846
Gene: ENSMUSG00000037236
AA Change: S596P

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000190121
AA Change: S258P

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140853
Gene: ENSMUSG00000037236
AA Change: S258P

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190653
AA Change: S258P

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000141135
Gene: ENSMUSG00000037236
AA Change: S258P

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Meta Mutation Damage Score 0.0651 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 88% (52/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear matrix protein, which is proposed to stabilize certain messenger RNA species. Mutations of this gene are associated with distal myopathy 2, which often includes vocal cord and pharyngeal weakness. Alternatively spliced transcript variants, including read-through transcripts composed of the upstream small nucleolar RNA host gene 4 (non-protein coding) and matrin 3 gene sequence, have been identified. Pseudogenes of this gene are located on chromosomes 1 and X. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a gene-trapped allele are early embryonic lethal. Heterozygotes show congenital heart defects including abnormal heart apex morphology, subaortic ventricular septal defects, double-outlet right ventricle, bicuspid aortic valve, aorta coarctation, and patent ductus arteriosus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,881,061 N190Y probably benign Het
2310035C23Rik T G 1: 105,687,347 N246K probably damaging Het
Abca6 T C 11: 110,184,670 M1332V probably benign Het
Afg3l2 T C 18: 67,440,443 K132R probably null Het
Arap3 T C 18: 37,984,365 D886G probably damaging Het
B3gntl1 G T 11: 121,651,676 probably null Het
Cdk12 T A 11: 98,219,074 S640R probably benign Het
Ceacam12 C A 7: 18,069,154 P162T probably benign Het
Chrna5 C A 9: 54,998,104 H67N probably benign Het
Copb1 T A 7: 114,219,572 D837V probably damaging Het
D11Wsu47e A G 11: 113,687,992 D71G probably benign Het
Dcaf5 C T 12: 80,338,832 R840H probably benign Het
Ect2l T A 10: 18,163,438 Q324L probably benign Het
Eef1e1 T C 13: 38,646,273 N141S probably damaging Het
Eif2ak4 A C 2: 118,412,963 N208T possibly damaging Het
Ext1 A G 15: 53,344,553 Y271H probably damaging Het
Fam173a A G 17: 25,790,657 V194A probably benign Het
Fbxo5 G A 10: 5,800,303 R323C possibly damaging Het
Fpr-rs3 C A 17: 20,624,226 A218S possibly damaging Het
Gm20499 G A 5: 114,817,021 probably benign Het
Gucy1b2 C A 14: 62,414,301 L400F possibly damaging Het
Hgd T A 16: 37,593,371 L24H probably benign Het
Hmx3 C A 7: 131,544,328 S255* probably null Het
Ifrd1 A T 12: 40,203,370 F448I probably damaging Het
Igfn1 T A 1: 135,966,840 E1996V probably benign Het
Itpr1 G A 6: 108,352,143 G173R probably damaging Het
Kbtbd8 T C 6: 95,118,534 S26P probably benign Het
Kctd17 A T 15: 78,437,133 probably benign Het
Mpp4 G A 1: 59,151,666 A90V probably benign Het
Mrpl20 G A 4: 155,806,921 R34Q probably damaging Het
Neb A T 2: 52,245,301 S3266T probably damaging Het
Nipal3 A G 4: 135,452,339 probably benign Het
Npas2 A T 1: 39,287,571 T46S possibly damaging Het
Nsd3 G T 8: 25,682,669 E815* probably null Het
Nup98 C A 7: 102,152,361 V786L probably benign Het
Olfr730 A T 14: 50,186,746 M157K possibly damaging Het
Pcdhb3 T C 18: 37,301,467 V162A probably benign Het
Pcgf2 G A 11: 97,690,291 P58L probably damaging Het
Penk A G 4: 4,134,318 F110L probably damaging Het
Scfd1 A G 12: 51,431,529 N508S probably benign Het
Scn2a T C 2: 65,764,483 V1892A probably benign Het
Sema6a G A 18: 47,248,826 R885C probably damaging Het
Sik2 T C 9: 50,895,845 H755R probably benign Het
Slc36a3 A T 11: 55,135,268 Y241* probably null Het
Smg5 T C 3: 88,351,618 probably benign Het
Spag9 A G 11: 94,114,253 T1049A probably benign Het
Tas2r103 T C 6: 133,036,945 M53V probably benign Het
Tpr C T 1: 150,423,541 A1090V probably damaging Het
Traf5 T A 1: 191,997,672 R473W probably damaging Het
Ush2a T C 1: 188,443,510 probably null Het
Vit A G 17: 78,546,426 T34A probably benign Het
Other mutations in Matr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Matr3 APN 18 35588389 missense probably damaging 1.00
IGL03083:Matr3 APN 18 35572418 missense probably damaging 0.96
IGL03117:Matr3 APN 18 35572657 missense probably damaging 1.00
IGL03163:Matr3 APN 18 35572591 missense probably damaging 0.99
IGL03381:Matr3 APN 18 35579025 splice site probably benign
R0456:Matr3 UTSW 18 35572864 missense probably damaging 1.00
R1136:Matr3 UTSW 18 35572895 missense probably damaging 1.00
R1459:Matr3 UTSW 18 35584656 missense probably benign 0.28
R1850:Matr3 UTSW 18 35582057 missense probably damaging 1.00
R1929:Matr3 UTSW 18 35588325 splice site probably benign
R2185:Matr3 UTSW 18 35581225 missense probably damaging 1.00
R2366:Matr3 UTSW 18 35588395 missense probably damaging 1.00
R2870:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2870:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2871:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2871:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2872:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2872:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2873:Matr3 UTSW 18 35572296 missense probably benign 0.25
R3908:Matr3 UTSW 18 35572841 missense probably damaging 1.00
R4400:Matr3 UTSW 18 35583916 missense possibly damaging 0.80
R4417:Matr3 UTSW 18 35572118 missense probably damaging 1.00
R4860:Matr3 UTSW 18 35581640 missense probably damaging 1.00
R4860:Matr3 UTSW 18 35581640 missense probably damaging 1.00
R4881:Matr3 UTSW 18 35572375 missense probably damaging 1.00
R4908:Matr3 UTSW 18 35572701 missense probably damaging 0.96
R5084:Matr3 UTSW 18 35582082 missense probably damaging 0.99
R5660:Matr3 UTSW 18 35572094 missense probably damaging 0.99
R5709:Matr3 UTSW 18 35581962 missense probably damaging 1.00
R5876:Matr3 UTSW 18 35587738 missense probably benign
R6392:Matr3 UTSW 18 35584841 missense probably benign 0.07
R7062:Matr3 UTSW 18 35579019 critical splice donor site probably null
R7156:Matr3 UTSW 18 35572921 missense probably damaging 0.98
R7228:Matr3 UTSW 18 35562484 missense unknown
R7389:Matr3 UTSW 18 35584585 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATCCCGGTAATTTGATTTTGCTTG -3'
(R):5'- TTCAAGAAGCATGCTGGGCTC -3'

Sequencing Primer
(F):5'- GGTCACATCACATCTATAGTCGGG -3'
(R):5'- AGCATGCTGGGCTCCTGTTC -3'
Posted On2016-12-15