Incidental Mutation 'R5779:Pcdhb3'
ID446903
Institutional Source Beutler Lab
Gene Symbol Pcdhb3
Ensembl Gene ENSMUSG00000045498
Gene Nameprotocadherin beta 3
SynonymsPcdhbC
MMRRC Submission 043377-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5779 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37300799-37304585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37301467 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 162 (V162A)
Ref Sequence ENSEMBL: ENSMUSP00000059180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056522] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051754
AA Change: V162A

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498
AA Change: V162A

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056522
SMART Domains Protein: ENSMUSP00000057921
Gene: ENSMUSG00000051599

DomainStartEndE-ValueType
Pfam:Cadherin_2 32 114 5.2e-33 PFAM
CA 157 242 1.74e-19 SMART
CA 266 347 5.99e-23 SMART
CA 370 451 1.16e-20 SMART
CA 475 561 5.94e-27 SMART
CA 591 672 2.03e-11 SMART
Pfam:Cadherin_C_2 688 771 3.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193025
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.0741 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 88% (52/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,881,061 N190Y probably benign Het
2310035C23Rik T G 1: 105,687,347 N246K probably damaging Het
Abca6 T C 11: 110,184,670 M1332V probably benign Het
Afg3l2 T C 18: 67,440,443 K132R probably null Het
Arap3 T C 18: 37,984,365 D886G probably damaging Het
B3gntl1 G T 11: 121,651,676 probably null Het
Cdk12 T A 11: 98,219,074 S640R probably benign Het
Ceacam12 C A 7: 18,069,154 P162T probably benign Het
Chrna5 C A 9: 54,998,104 H67N probably benign Het
Copb1 T A 7: 114,219,572 D837V probably damaging Het
D11Wsu47e A G 11: 113,687,992 D71G probably benign Het
Dcaf5 C T 12: 80,338,832 R840H probably benign Het
Ect2l T A 10: 18,163,438 Q324L probably benign Het
Eef1e1 T C 13: 38,646,273 N141S probably damaging Het
Eif2ak4 A C 2: 118,412,963 N208T possibly damaging Het
Ext1 A G 15: 53,344,553 Y271H probably damaging Het
Fam173a A G 17: 25,790,657 V194A probably benign Het
Fbxo5 G A 10: 5,800,303 R323C possibly damaging Het
Fpr-rs3 C A 17: 20,624,226 A218S possibly damaging Het
Gm20499 G A 5: 114,817,021 probably benign Het
Gucy1b2 C A 14: 62,414,301 L400F possibly damaging Het
Hgd T A 16: 37,593,371 L24H probably benign Het
Hmx3 C A 7: 131,544,328 S255* probably null Het
Ifrd1 A T 12: 40,203,370 F448I probably damaging Het
Igfn1 T A 1: 135,966,840 E1996V probably benign Het
Itpr1 G A 6: 108,352,143 G173R probably damaging Het
Kbtbd8 T C 6: 95,118,534 S26P probably benign Het
Kctd17 A T 15: 78,437,133 probably benign Het
Matr3 T C 18: 35,584,522 S258P possibly damaging Het
Mpp4 G A 1: 59,151,666 A90V probably benign Het
Mrpl20 G A 4: 155,806,921 R34Q probably damaging Het
Neb A T 2: 52,245,301 S3266T probably damaging Het
Nipal3 A G 4: 135,452,339 probably benign Het
Npas2 A T 1: 39,287,571 T46S possibly damaging Het
Nsd3 G T 8: 25,682,669 E815* probably null Het
Nup98 C A 7: 102,152,361 V786L probably benign Het
Olfr730 A T 14: 50,186,746 M157K possibly damaging Het
Pcgf2 G A 11: 97,690,291 P58L probably damaging Het
Penk A G 4: 4,134,318 F110L probably damaging Het
Scfd1 A G 12: 51,431,529 N508S probably benign Het
Scn2a T C 2: 65,764,483 V1892A probably benign Het
Sema6a G A 18: 47,248,826 R885C probably damaging Het
Sik2 T C 9: 50,895,845 H755R probably benign Het
Slc36a3 A T 11: 55,135,268 Y241* probably null Het
Smg5 T C 3: 88,351,618 probably benign Het
Spag9 A G 11: 94,114,253 T1049A probably benign Het
Tas2r103 T C 6: 133,036,945 M53V probably benign Het
Tpr C T 1: 150,423,541 A1090V probably damaging Het
Traf5 T A 1: 191,997,672 R473W probably damaging Het
Ush2a T C 1: 188,443,510 probably null Het
Vit A G 17: 78,546,426 T34A probably benign Het
Other mutations in Pcdhb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Pcdhb3 APN 18 37302948 missense probably benign 0.12
IGL01568:Pcdhb3 APN 18 37302001 missense possibly damaging 0.74
IGL02541:Pcdhb3 APN 18 37302145 missense probably damaging 0.99
IGL02852:Pcdhb3 APN 18 37302097 missense probably damaging 1.00
IGL03140:Pcdhb3 APN 18 37301219 missense probably benign 0.00
IGL03336:Pcdhb3 APN 18 37302961 missense possibly damaging 0.86
R0380:Pcdhb3 UTSW 18 37302157 missense possibly damaging 0.48
R1558:Pcdhb3 UTSW 18 37301581 missense probably damaging 1.00
R1713:Pcdhb3 UTSW 18 37303322 missense probably benign
R1728:Pcdhb3 UTSW 18 37301878 missense probably damaging 1.00
R1784:Pcdhb3 UTSW 18 37301878 missense probably damaging 1.00
R1838:Pcdhb3 UTSW 18 37301317 missense probably benign 0.00
R2079:Pcdhb3 UTSW 18 37303309 missense possibly damaging 0.93
R2164:Pcdhb3 UTSW 18 37302186 missense possibly damaging 0.78
R2513:Pcdhb3 UTSW 18 37301239 nonsense probably null
R2513:Pcdhb3 UTSW 18 37301240 missense probably damaging 1.00
R2513:Pcdhb3 UTSW 18 37301241 missense probably benign 0.17
R3080:Pcdhb3 UTSW 18 37301482 missense probably damaging 1.00
R3755:Pcdhb3 UTSW 18 37302825 missense probably damaging 0.97
R3756:Pcdhb3 UTSW 18 37302825 missense probably damaging 0.97
R3862:Pcdhb3 UTSW 18 37303276 missense probably damaging 1.00
R3863:Pcdhb3 UTSW 18 37303276 missense probably damaging 1.00
R3864:Pcdhb3 UTSW 18 37303276 missense probably damaging 1.00
R4114:Pcdhb3 UTSW 18 37302040 missense probably benign 0.03
R4895:Pcdhb3 UTSW 18 37301706 missense probably damaging 1.00
R4917:Pcdhb3 UTSW 18 37302399 missense probably damaging 0.99
R5508:Pcdhb3 UTSW 18 37301126 missense probably damaging 1.00
R5848:Pcdhb3 UTSW 18 37301647 missense probably benign 0.39
R5991:Pcdhb3 UTSW 18 37301508 missense probably benign 0.07
R6014:Pcdhb3 UTSW 18 37302653 missense probably damaging 1.00
R6111:Pcdhb3 UTSW 18 37302189 missense probably benign 0.00
R6282:Pcdhb3 UTSW 18 37301646 missense probably damaging 1.00
R6339:Pcdhb3 UTSW 18 37300945 intron probably benign
R6425:Pcdhb3 UTSW 18 37302475 missense possibly damaging 0.64
R6860:Pcdhb3 UTSW 18 37301710 missense probably benign 0.01
R6896:Pcdhb3 UTSW 18 37301212 missense probably damaging 1.00
R6946:Pcdhb3 UTSW 18 37302619 missense probably damaging 1.00
R7110:Pcdhb3 UTSW 18 37302922 missense possibly damaging 0.87
R7236:Pcdhb3 UTSW 18 37301452 missense probably damaging 1.00
R7402:Pcdhb3 UTSW 18 37301604 missense probably benign
R7469:Pcdhb3 UTSW 18 37301335 missense probably benign 0.02
R7723:Pcdhb3 UTSW 18 37302512 missense probably damaging 0.98
R7738:Pcdhb3 UTSW 18 37302959 missense probably benign 0.00
R7800:Pcdhb3 UTSW 18 37301921 missense probably benign 0.00
R7817:Pcdhb3 UTSW 18 37302929 missense probably benign
X0026:Pcdhb3 UTSW 18 37301764 missense probably damaging 0.96
X0066:Pcdhb3 UTSW 18 37302339 nonsense probably null
Z1177:Pcdhb3 UTSW 18 37302036
Predicted Primers PCR Primer
(F):5'- TGTGCTGCACTTTCAGATATTG -3'
(R):5'- TGTGTCTAAGACCAGGATGTG -3'

Sequencing Primer
(F):5'- GCACTTTCAGATATTGCTGCATG -3'
(R):5'- TGGGTAGTTCCAGAACGAGGC -3'
Posted On2016-12-15