Incidental Mutation 'R5779:Arap3'
ID446904
Institutional Source Beutler Lab
Gene Symbol Arap3
Ensembl Gene ENSMUSG00000024451
Gene NameArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
SynonymsDRAG1, E030006K04Rik, Centd3
MMRRC Submission 043377-MU
Accession Numbers

NCBI RefSeq: NM_139206.2, NM_001205336.1; MGI:2147274

Is this an essential gene? Possibly essential (E-score: 0.731) question?
Stock #R5779 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37972624-37997574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37984365 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 886 (D886G)
Ref Sequence ENSEMBL: ENSMUSP00000035662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042944]
Predicted Effect probably damaging
Transcript: ENSMUST00000042944
AA Change: D886G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035662
Gene: ENSMUSG00000024451
AA Change: D886G

DomainStartEndE-ValueType
SAM 1 68 1.5e-7 SMART
low complexity region 81 98 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
PH 283 376 3.4e-16 SMART
PH 390 480 1.61e-8 SMART
ArfGap 484 606 1.44e-25 SMART
low complexity region 642 661 N/A INTRINSIC
PH 671 785 2.86e1 SMART
PH 795 901 6.87e-3 SMART
RhoGAP 913 1089 2.11e-47 SMART
Pfam:RA 1113 1206 6.2e-16 PFAM
PH 1220 1323 3.46e-8 SMART
low complexity region 1388 1407 N/A INTRINSIC
low complexity region 1457 1469 N/A INTRINSIC
low complexity region 1475 1486 N/A INTRINSIC
low complexity region 1494 1529 N/A INTRINSIC
Meta Mutation Damage Score 0.8164 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 88% (52/59)
MGI Phenotype Strain: 5428754
Lethality: E10-E11
FUNCTION: This gene encodes a phosphoinositide binding protein containing ARF-GAP, RHO-GAP, RAS-associating, and pleckstrin homology domains. The ARF-GAP and RHO-GAP domains cooperate in mediating rearrangements in the cell cytoskeleton and cell shape. It is a specific PtdIns(3,4,5)P3/PtdIns(3,4)P2-stimulated Arf6-GAP protein. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele die around E11 exhibiting pallor, embryonic growth arrest, yolk sac and placental abnormalities, and an endothelial cell-autonomous defect in sprouting angiogenesis. Knock-in mice homozygous for a point mutation display similar angiogenesis defects. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,881,061 N190Y probably benign Het
2310035C23Rik T G 1: 105,687,347 N246K probably damaging Het
Abca6 T C 11: 110,184,670 M1332V probably benign Het
Afg3l2 T C 18: 67,440,443 K132R probably null Het
B3gntl1 G T 11: 121,651,676 probably null Het
Cdk12 T A 11: 98,219,074 S640R probably benign Het
Ceacam12 C A 7: 18,069,154 P162T probably benign Het
Chrna5 C A 9: 54,998,104 H67N probably benign Het
Copb1 T A 7: 114,219,572 D837V probably damaging Het
D11Wsu47e A G 11: 113,687,992 D71G probably benign Het
Dcaf5 C T 12: 80,338,832 R840H probably benign Het
Ect2l T A 10: 18,163,438 Q324L probably benign Het
Eef1e1 T C 13: 38,646,273 N141S probably damaging Het
Eif2ak4 A C 2: 118,412,963 N208T possibly damaging Het
Ext1 A G 15: 53,344,553 Y271H probably damaging Het
Fam173a A G 17: 25,790,657 V194A probably benign Het
Fbxo5 G A 10: 5,800,303 R323C possibly damaging Het
Fpr-rs3 C A 17: 20,624,226 A218S possibly damaging Het
Gm20499 G A 5: 114,817,021 probably benign Het
Gucy1b2 C A 14: 62,414,301 L400F possibly damaging Het
Hgd T A 16: 37,593,371 L24H probably benign Het
Hmx3 C A 7: 131,544,328 S255* probably null Het
Ifrd1 A T 12: 40,203,370 F448I probably damaging Het
Igfn1 T A 1: 135,966,840 E1996V probably benign Het
Itpr1 G A 6: 108,352,143 G173R probably damaging Het
Kbtbd8 T C 6: 95,118,534 S26P probably benign Het
Kctd17 A T 15: 78,437,133 probably benign Het
Matr3 T C 18: 35,584,522 S258P possibly damaging Het
Mpp4 G A 1: 59,151,666 A90V probably benign Het
Mrpl20 G A 4: 155,806,921 R34Q probably damaging Het
Neb A T 2: 52,245,301 S3266T probably damaging Het
Nipal3 A G 4: 135,452,339 probably benign Het
Npas2 A T 1: 39,287,571 T46S possibly damaging Het
Nsd3 G T 8: 25,682,669 E815* probably null Het
Nup98 C A 7: 102,152,361 V786L probably benign Het
Olfr730 A T 14: 50,186,746 M157K possibly damaging Het
Pcdhb3 T C 18: 37,301,467 V162A probably benign Het
Pcgf2 G A 11: 97,690,291 P58L probably damaging Het
Penk A G 4: 4,134,318 F110L probably damaging Het
Scfd1 A G 12: 51,431,529 N508S probably benign Het
Scn2a T C 2: 65,764,483 V1892A probably benign Het
Sema6a G A 18: 47,248,826 R885C probably damaging Het
Sik2 T C 9: 50,895,845 H755R probably benign Het
Slc36a3 A T 11: 55,135,268 Y241* probably null Het
Smg5 T C 3: 88,351,618 probably benign Het
Spag9 A G 11: 94,114,253 T1049A probably benign Het
Tas2r103 T C 6: 133,036,945 M53V probably benign Het
Tpr C T 1: 150,423,541 A1090V probably damaging Het
Traf5 T A 1: 191,997,672 R473W probably damaging Het
Ush2a T C 1: 188,443,510 probably null Het
Vit A G 17: 78,546,426 T34A probably benign Het
Other mutations in Arap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Arap3 APN 18 37975926 missense probably damaging 1.00
IGL01145:Arap3 APN 18 37989179 missense probably benign
IGL01154:Arap3 APN 18 37996734 missense probably benign 0.28
IGL01305:Arap3 APN 18 37991327 critical splice donor site probably null
IGL01542:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01543:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01544:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01545:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01677:Arap3 APN 18 37996647 missense probably benign
IGL01925:Arap3 APN 18 37984246 missense probably benign 0.21
IGL01933:Arap3 APN 18 37978453 missense possibly damaging 0.65
IGL02048:Arap3 APN 18 37996979 missense possibly damaging 0.56
IGL02064:Arap3 APN 18 37991701 missense probably damaging 1.00
IGL02207:Arap3 APN 18 37987853 missense probably benign 0.00
IGL02376:Arap3 APN 18 37978453 missense possibly damaging 0.95
IGL02531:Arap3 APN 18 37989751 missense probably damaging 0.99
IGL02568:Arap3 APN 18 37996658 missense probably benign 0.32
IGL02640:Arap3 APN 18 37987802 missense possibly damaging 0.71
IGL02658:Arap3 APN 18 37990994 missense probably benign 0.09
IGL03090:Arap3 APN 18 37989112 missense probably benign 0.00
IGL03352:Arap3 APN 18 37981302 splice site probably benign
ANU22:Arap3 UTSW 18 37991327 critical splice donor site probably null
P0016:Arap3 UTSW 18 37984348 missense probably benign 0.00
PIT4260001:Arap3 UTSW 18 37996895 missense probably benign 0.08
R0066:Arap3 UTSW 18 37996707 missense probably benign 0.01
R0324:Arap3 UTSW 18 37973225 missense possibly damaging 0.93
R0562:Arap3 UTSW 18 37975540 missense probably damaging 1.00
R1289:Arap3 UTSW 18 37981973 missense possibly damaging 0.95
R1346:Arap3 UTSW 18 37975918 missense probably damaging 1.00
R1419:Arap3 UTSW 18 37978432 missense possibly damaging 0.51
R1470:Arap3 UTSW 18 37989196 critical splice acceptor site probably null
R1470:Arap3 UTSW 18 37989196 critical splice acceptor site probably null
R1537:Arap3 UTSW 18 37989684 critical splice donor site probably null
R1644:Arap3 UTSW 18 37984245 missense probably damaging 1.00
R1731:Arap3 UTSW 18 37989912 missense probably benign 0.01
R1758:Arap3 UTSW 18 37989912 missense probably benign 0.01
R1843:Arap3 UTSW 18 37975583 missense probably damaging 1.00
R1907:Arap3 UTSW 18 37996671 missense probably benign 0.28
R1954:Arap3 UTSW 18 37982002 missense probably damaging 1.00
R2124:Arap3 UTSW 18 37973350 missense probably damaging 0.98
R2135:Arap3 UTSW 18 37974456 missense probably damaging 1.00
R2172:Arap3 UTSW 18 37990560 missense probably damaging 1.00
R2418:Arap3 UTSW 18 37989944 missense probably damaging 1.00
R2419:Arap3 UTSW 18 37989944 missense probably damaging 1.00
R2907:Arap3 UTSW 18 37990527 missense possibly damaging 0.88
R4425:Arap3 UTSW 18 37978600 missense probably damaging 1.00
R4669:Arap3 UTSW 18 37996254 missense probably benign 0.08
R4734:Arap3 UTSW 18 37996275 missense probably benign 0.00
R4815:Arap3 UTSW 18 37973243 missense probably benign
R5328:Arap3 UTSW 18 37991687 missense possibly damaging 0.92
R5350:Arap3 UTSW 18 37982035 missense probably damaging 1.00
R5466:Arap3 UTSW 18 37996736 missense probably benign 0.00
R5482:Arap3 UTSW 18 37974674 missense possibly damaging 0.95
R5572:Arap3 UTSW 18 37991066 missense probably damaging 1.00
R6053:Arap3 UTSW 18 37990771 missense probably damaging 0.98
R6144:Arap3 UTSW 18 37985433 missense probably damaging 0.98
R6166:Arap3 UTSW 18 37974370 missense probably damaging 1.00
R6248:Arap3 UTSW 18 37991354 missense probably benign 0.09
R6266:Arap3 UTSW 18 37990791 missense probably damaging 0.98
R6385:Arap3 UTSW 18 37997031 nonsense probably null
R6694:Arap3 UTSW 18 37991537 critical splice donor site probably null
R6856:Arap3 UTSW 18 37979863 missense possibly damaging 0.95
R7073:Arap3 UTSW 18 37974442 nonsense probably null
R7297:Arap3 UTSW 18 37973563 missense possibly damaging 0.81
R7352:Arap3 UTSW 18 37973278 missense probably benign 0.00
R7652:Arap3 UTSW 18 37978452 missense probably damaging 0.99
R7726:Arap3 UTSW 18 37989467 missense probably damaging 0.99
X0011:Arap3 UTSW 18 37974101 critical splice donor site probably null
X0026:Arap3 UTSW 18 37985311 critical splice donor site probably null
X0027:Arap3 UTSW 18 37973485 unclassified probably null
X0066:Arap3 UTSW 18 37991646 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCCAACTAGCTCAGTGTC -3'
(R):5'- ACAGGAAGGTAATGTTCTGTACC -3'

Sequencing Primer
(F):5'- CAACTAGCTCAGTGTCAATCTGTG -3'
(R):5'- AAGGTAATGTTCTGTACCTGTGACTC -3'
Posted On2016-12-15