Incidental Mutation 'R5780:Cdk5rap1'
ID 446915
Institutional Source Beutler Lab
Gene Symbol Cdk5rap1
Ensembl Gene ENSMUSG00000027487
Gene Name CDK5 regulatory subunit associated protein 1
Synonyms 2310066P17Rik
MMRRC Submission 043205-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.348) question?
Stock # R5780 (G1)
Quality Score 217
Status Not validated
Chromosome 2
Chromosomal Location 154177300-154214930 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) CTT to CT at 154187788 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028990] [ENSMUST00000109731]
AlphaFold Q8BTW8
Predicted Effect probably null
Transcript: ENSMUST00000028990
SMART Domains Protein: ENSMUSP00000028990
Gene: ENSMUSG00000027487

DomainStartEndE-ValueType
Pfam:UPF0004 100 203 3.2e-31 PFAM
Elp3 247 486 4.83e-52 SMART
Pfam:TRAM 500 574 1.2e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109731
SMART Domains Protein: ENSMUSP00000105353
Gene: ENSMUSG00000027487

DomainStartEndE-ValueType
Pfam:UPF0004 100 203 1.1e-31 PFAM
Elp3 247 486 4.83e-52 SMART
Pfam:TRAM 500 574 1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152180
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of cyclin-dependent kinase 5 activity. This protein has also been reported to modify RNA by adding a methylthio-group and may thus have a dual function as an RNA methylthiotransferase and as an inhibitor of cyclin-dependent kinase 5 activity. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele show deficient mitochondrial tRNA modification, reduced mitochondrial protein synthesis, defects in oxidative phosphorylation, high susceptibility to stress-induced mitochondrial remodeling, and accelerated myopathy and cardiac dysfunction under stressed conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik C T 1: 85,646,039 (GRCm39) A189T probably benign Het
Acsm4 A G 7: 119,293,068 (GRCm39) E66G possibly damaging Het
Afm A G 5: 90,699,290 (GRCm39) E578G possibly damaging Het
Alox5 A T 6: 116,397,310 (GRCm39) D291E probably benign Het
Apoa4 A G 9: 46,153,890 (GRCm39) M164V possibly damaging Het
Atp6v1a A T 16: 43,935,006 (GRCm39) M61K probably benign Het
Avp A G 2: 130,422,629 (GRCm39) S159P probably benign Het
Bicra A T 7: 15,713,679 (GRCm39) L841Q possibly damaging Het
Clasp2 T G 9: 113,679,220 (GRCm39) L246R probably damaging Het
Dhdds G A 4: 133,724,141 (GRCm39) L58F probably damaging Het
Dmkn A G 7: 30,477,040 (GRCm39) D227G probably damaging Het
Dnah7a G A 1: 53,522,478 (GRCm39) A2920V probably benign Het
Epb41l1 C T 2: 156,338,445 (GRCm39) R163W probably damaging Het
Etfbkmt T A 6: 149,048,657 (GRCm39) Y99N probably damaging Het
Fat4 T C 3: 39,035,104 (GRCm39) Y2919H probably damaging Het
Fcgbp T A 7: 27,784,643 (GRCm39) D234E probably benign Het
Frem1 T C 4: 82,868,652 (GRCm39) D1443G probably benign Het
Fscn2 A C 11: 120,257,494 (GRCm39) E285A probably benign Het
Hmga2 T A 10: 120,298,583 (GRCm39) R79* probably null Het
Hrh3 A T 2: 179,742,608 (GRCm39) V308E probably damaging Het
Hsd11b2 G A 8: 106,248,787 (GRCm39) G93D probably damaging Het
Hydin T C 8: 111,312,712 (GRCm39) F4151S probably damaging Het
Ica1l C A 1: 60,067,374 (GRCm39) E5D probably benign Het
Kcnma1 C A 14: 23,436,419 (GRCm39) E640* probably null Het
Mdn1 C T 4: 32,722,950 (GRCm39) H2422Y probably benign Het
Mgarp T C 3: 51,299,269 (GRCm39) T47A probably damaging Het
Mmp13 T G 9: 7,278,952 (GRCm39) F348V possibly damaging Het
Mov10l1 A G 15: 88,896,181 (GRCm39) D675G probably benign Het
Mtcl2 A G 2: 156,860,410 (GRCm39) C1610R probably damaging Het
Nxpe3 T A 16: 55,686,804 (GRCm39) Q68L probably damaging Het
Or4k41 A T 2: 111,280,178 (GRCm39) D231V probably benign Het
Or6c208 T C 10: 129,223,939 (GRCm39) S146P probably damaging Het
Or7e175 T A 9: 20,048,793 (GRCm39) M127K probably damaging Het
Pald1 A T 10: 61,174,997 (GRCm39) I751N probably damaging Het
Pramel19 C T 4: 101,798,724 (GRCm39) L232F probably damaging Het
Prickle2 T C 6: 92,435,593 (GRCm39) T3A probably benign Het
Ros1 A T 10: 52,070,953 (GRCm39) C34S probably damaging Het
Sema3f A G 9: 107,559,788 (GRCm39) L702P probably damaging Het
Sptbn2 T A 19: 4,774,695 (GRCm39) L116Q probably damaging Het
Stard9 T C 2: 120,533,877 (GRCm39) V3378A probably benign Het
Sycp2l A G 13: 41,282,976 (GRCm39) I158V possibly damaging Het
Tbc1d10b G A 7: 126,797,925 (GRCm39) R739W possibly damaging Het
Tnik T C 3: 28,648,241 (GRCm39) M431T probably benign Het
Ube4b C T 4: 149,415,821 (GRCm39) R1091Q probably benign Het
Vwce C A 19: 10,627,983 (GRCm39) P481Q probably damaging Het
Zfp1005 T A 2: 150,108,139 (GRCm39) M33K probably benign Het
Other mutations in Cdk5rap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Cdk5rap1 APN 2 154,207,956 (GRCm39) missense probably damaging 1.00
IGL02162:Cdk5rap1 APN 2 154,177,489 (GRCm39) missense probably damaging 0.98
IGL02626:Cdk5rap1 APN 2 154,207,880 (GRCm39) critical splice donor site probably null
IGL03278:Cdk5rap1 APN 2 154,212,622 (GRCm39) missense probably benign 0.00
R1052:Cdk5rap1 UTSW 2 154,202,519 (GRCm39) missense possibly damaging 0.96
R1333:Cdk5rap1 UTSW 2 154,202,574 (GRCm39) missense probably damaging 0.97
R1552:Cdk5rap1 UTSW 2 154,212,615 (GRCm39) missense probably benign 0.00
R1553:Cdk5rap1 UTSW 2 154,194,171 (GRCm39) missense probably damaging 1.00
R2107:Cdk5rap1 UTSW 2 154,195,166 (GRCm39) missense probably benign 0.22
R3946:Cdk5rap1 UTSW 2 154,190,636 (GRCm39) missense probably damaging 1.00
R4126:Cdk5rap1 UTSW 2 154,210,815 (GRCm39) missense probably damaging 1.00
R4715:Cdk5rap1 UTSW 2 154,203,755 (GRCm39) makesense probably null
R4865:Cdk5rap1 UTSW 2 154,212,876 (GRCm39) critical splice acceptor site probably null
R4866:Cdk5rap1 UTSW 2 154,212,876 (GRCm39) critical splice acceptor site probably null
R4867:Cdk5rap1 UTSW 2 154,212,876 (GRCm39) critical splice acceptor site probably null
R4946:Cdk5rap1 UTSW 2 154,210,794 (GRCm39) missense possibly damaging 0.91
R5087:Cdk5rap1 UTSW 2 154,184,315 (GRCm39) missense probably damaging 1.00
R5319:Cdk5rap1 UTSW 2 154,177,489 (GRCm39) missense possibly damaging 0.62
R5383:Cdk5rap1 UTSW 2 154,192,755 (GRCm39) missense possibly damaging 0.78
R5582:Cdk5rap1 UTSW 2 154,187,894 (GRCm39) missense probably benign 0.01
R6262:Cdk5rap1 UTSW 2 154,212,606 (GRCm39) missense probably benign 0.04
R6274:Cdk5rap1 UTSW 2 154,210,161 (GRCm39) missense probably damaging 0.99
R7263:Cdk5rap1 UTSW 2 154,202,652 (GRCm39) missense probably benign 0.12
R7388:Cdk5rap1 UTSW 2 154,202,595 (GRCm39) missense probably damaging 1.00
R7650:Cdk5rap1 UTSW 2 154,196,036 (GRCm39) missense probably benign 0.01
R8424:Cdk5rap1 UTSW 2 154,187,932 (GRCm39) missense probably damaging 1.00
R8694:Cdk5rap1 UTSW 2 154,195,148 (GRCm39) nonsense probably null
R9295:Cdk5rap1 UTSW 2 154,194,186 (GRCm39) missense probably damaging 1.00
R9413:Cdk5rap1 UTSW 2 154,207,880 (GRCm39) critical splice donor site probably null
R9453:Cdk5rap1 UTSW 2 154,190,585 (GRCm39) missense probably damaging 1.00
R9466:Cdk5rap1 UTSW 2 154,192,756 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AGTTTGCCAAGGTCATAAGACAC -3'
(R):5'- GGATTTGACAAGTCCTTAATGACC -3'

Sequencing Primer
(F):5'- ACCTGAGCATGATGGTGTAATCCC -3'
(R):5'- GACAAGTCCTTAATGACCTTTATCC -3'
Posted On 2016-12-15