Incidental Mutation 'R5780:Cdk5rap1'
ID446915
Institutional Source Beutler Lab
Gene Symbol Cdk5rap1
Ensembl Gene ENSMUSG00000027487
Gene NameCDK5 regulatory subunit associated protein 1
Synonyms
MMRRC Submission 043205-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.679) question?
Stock #R5780 (G1)
Quality Score217
Status Not validated
Chromosome2
Chromosomal Location154335380-154373010 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTT to CT at 154345868 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028990] [ENSMUST00000109731]
Predicted Effect probably null
Transcript: ENSMUST00000028990
SMART Domains Protein: ENSMUSP00000028990
Gene: ENSMUSG00000027487

DomainStartEndE-ValueType
Pfam:UPF0004 100 203 3.2e-31 PFAM
Elp3 247 486 4.83e-52 SMART
Pfam:TRAM 500 574 1.2e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109731
SMART Domains Protein: ENSMUSP00000105353
Gene: ENSMUSG00000027487

DomainStartEndE-ValueType
Pfam:UPF0004 100 203 1.1e-31 PFAM
Elp3 247 486 4.83e-52 SMART
Pfam:TRAM 500 574 1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152180
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of cyclin-dependent kinase 5 activity. This protein has also been reported to modify RNA by adding a methylthio-group and may thus have a dual function as an RNA methylthiotransferase and as an inhibitor of cyclin-dependent kinase 5 activity. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele show deficient mitochondrial tRNA modification, reduced mitochondrial protein synthesis, defects in oxidative phosphorylation, high susceptibility to stress-induced mitochondrial remodeling, and accelerated myopathy and cardiac dysfunction under stressed conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik C T 1: 85,718,318 A189T probably benign Het
Acsm4 A G 7: 119,693,845 E66G possibly damaging Het
Afm A G 5: 90,551,431 E578G possibly damaging Het
Alox5 A T 6: 116,420,349 D291E probably benign Het
Apoa4 A G 9: 46,242,592 M164V possibly damaging Het
Atp6v1a A T 16: 44,114,643 M61K probably benign Het
Avp A G 2: 130,580,709 S159P probably benign Het
Bicra A T 7: 15,979,754 L841Q possibly damaging Het
Clasp2 T G 9: 113,850,152 L246R probably damaging Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dmkn A G 7: 30,777,615 D227G probably damaging Het
Dnah7a G A 1: 53,483,319 A2920V probably benign Het
Epb41l1 C T 2: 156,496,525 R163W probably damaging Het
Etfbkmt T A 6: 149,147,159 Y99N probably damaging Het
Fat4 T C 3: 38,980,955 Y2919H probably damaging Het
Fcgbp T A 7: 28,085,218 D234E probably benign Het
Frem1 T C 4: 82,950,415 D1443G probably benign Het
Fscn2 A C 11: 120,366,668 E285A probably benign Het
Gm12794 C T 4: 101,941,527 L232F probably damaging Het
Gm14124 T A 2: 150,266,219 M33K probably benign Het
Hmga2 T A 10: 120,462,678 R79* probably null Het
Hrh3 A T 2: 180,100,815 V308E probably damaging Het
Hsd11b2 G A 8: 105,522,155 G93D probably damaging Het
Hydin T C 8: 110,586,080 F4151S probably damaging Het
Ica1l C A 1: 60,028,215 E5D probably benign Het
Kcnma1 C A 14: 23,386,351 E640* probably null Het
Mdn1 C T 4: 32,722,950 H2422Y probably benign Het
Mgarp T C 3: 51,391,848 T47A probably damaging Het
Mmp13 T G 9: 7,278,952 F348V possibly damaging Het
Mov10l1 A G 15: 89,011,978 D675G probably benign Het
Nxpe3 T A 16: 55,866,441 Q68L probably damaging Het
Olfr1287 A T 2: 111,449,833 D231V probably benign Het
Olfr784 T C 10: 129,388,070 S146P probably damaging Het
Olfr869 T A 9: 20,137,497 M127K probably damaging Het
Pald1 A T 10: 61,339,218 I751N probably damaging Het
Prickle2 T C 6: 92,458,612 T3A probably benign Het
Ros1 A T 10: 52,194,857 C34S probably damaging Het
Sema3f A G 9: 107,682,589 L702P probably damaging Het
Soga1 A G 2: 157,018,490 C1610R probably damaging Het
Sptbn2 T A 19: 4,724,667 L116Q probably damaging Het
Stard9 T C 2: 120,703,396 V3378A probably benign Het
Sycp2l A G 13: 41,129,500 I158V possibly damaging Het
Tbc1d10b G A 7: 127,198,753 R739W possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Ube4b C T 4: 149,331,364 R1091Q probably benign Het
Vwce C A 19: 10,650,619 P481Q probably damaging Het
Other mutations in Cdk5rap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Cdk5rap1 APN 2 154366036 missense probably damaging 1.00
IGL02162:Cdk5rap1 APN 2 154335569 missense probably damaging 0.98
IGL02626:Cdk5rap1 APN 2 154365960 critical splice donor site probably null
IGL03278:Cdk5rap1 APN 2 154370702 missense probably benign 0.00
R1052:Cdk5rap1 UTSW 2 154360599 missense possibly damaging 0.96
R1333:Cdk5rap1 UTSW 2 154360654 missense probably damaging 0.97
R1552:Cdk5rap1 UTSW 2 154370695 missense probably benign 0.00
R1553:Cdk5rap1 UTSW 2 154352251 missense probably damaging 1.00
R2107:Cdk5rap1 UTSW 2 154353246 missense probably benign 0.22
R3946:Cdk5rap1 UTSW 2 154348716 missense probably damaging 1.00
R4126:Cdk5rap1 UTSW 2 154368895 missense probably damaging 1.00
R4715:Cdk5rap1 UTSW 2 154361835 makesense probably null
R4865:Cdk5rap1 UTSW 2 154370956 critical splice acceptor site probably null
R4866:Cdk5rap1 UTSW 2 154370956 critical splice acceptor site probably null
R4867:Cdk5rap1 UTSW 2 154370956 critical splice acceptor site probably null
R4946:Cdk5rap1 UTSW 2 154368874 missense possibly damaging 0.91
R5087:Cdk5rap1 UTSW 2 154342395 missense probably damaging 1.00
R5319:Cdk5rap1 UTSW 2 154335569 missense possibly damaging 0.62
R5383:Cdk5rap1 UTSW 2 154350835 missense possibly damaging 0.78
R5582:Cdk5rap1 UTSW 2 154345974 missense probably benign 0.01
R6262:Cdk5rap1 UTSW 2 154370686 missense probably benign 0.04
R6274:Cdk5rap1 UTSW 2 154368241 missense probably damaging 0.99
R7263:Cdk5rap1 UTSW 2 154360732 missense probably benign 0.12
R7388:Cdk5rap1 UTSW 2 154360675 missense probably damaging 1.00
R7650:Cdk5rap1 UTSW 2 154354116 missense probably benign 0.01
R8424:Cdk5rap1 UTSW 2 154346012 missense probably damaging 1.00
R8694:Cdk5rap1 UTSW 2 154353228 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTTTGCCAAGGTCATAAGACAC -3'
(R):5'- GGATTTGACAAGTCCTTAATGACC -3'

Sequencing Primer
(F):5'- ACCTGAGCATGATGGTGTAATCCC -3'
(R):5'- GACAAGTCCTTAATGACCTTTATCC -3'
Posted On2016-12-15